From d8543bb6618c17b12da906afa77d216f58cf4058 Mon Sep 17 00:00:00 2001 From: Upstream Date: Mon, 12 Jan 1970 13:46:40 +0000 Subject: external/webkit r30707 --- SunSpider/TODO | 70 + SunSpider/UNCOVERED | 99 ++ SunSpider/hosted/sunspider-driver.html | 96 ++ SunSpider/hosted/sunspider-record-result.js | 31 + SunSpider/hosted/sunspider-results.html | 91 ++ SunSpider/hosted/sunspider.css | 31 + SunSpider/hosted/sunspider.html | 78 + SunSpider/make-hosted | 77 + SunSpider/resources/TEMPLATE.html | 50 + SunSpider/resources/sunspider-analyze-results.js | 268 +++ SunSpider/resources/sunspider-compare-results.js | 380 +++++ .../resources/sunspider-standalone-compare.js | 26 + SunSpider/resources/sunspider-standalone-driver.js | 53 + SunSpider/sunspider | 214 +++ SunSpider/sunspider-compare-results | 142 ++ SunSpider/tests/3d-cube.js | 337 ++++ SunSpider/tests/3d-morph.js | 54 + SunSpider/tests/3d-raytrace.js | 441 +++++ SunSpider/tests/LIST | 26 + SunSpider/tests/access-binary-trees.js | 50 + SunSpider/tests/access-fannkuch.js | 66 + SunSpider/tests/access-nbody.js | 169 ++ SunSpider/tests/access-nsieve.js | 38 + SunSpider/tests/bitops-3bit-bits-in-byte.js | 32 + SunSpider/tests/bitops-bits-in-byte.js | 21 + SunSpider/tests/bitops-bitwise-and.js | 28 + SunSpider/tests/bitops-nsieve-bits.js | 32 + SunSpider/tests/controlflow-recursive.js | 25 + SunSpider/tests/crypto-aes.js | 422 +++++ SunSpider/tests/crypto-md5.js | 286 ++++ SunSpider/tests/crypto-sha1.js | 224 +++ SunSpider/tests/date-format-tofte.js | 299 ++++ SunSpider/tests/date-format-xparb.js | 417 +++++ SunSpider/tests/math-cordic.js | 95 ++ SunSpider/tests/math-partial-sums.js | 33 + SunSpider/tests/math-spectral-norm.js | 51 + SunSpider/tests/regexp-dna.js | 1712 ++++++++++++++++++++ SunSpider/tests/string-base64.js | 135 ++ SunSpider/tests/string-fasta.js | 85 + SunSpider/tests/string-tagcloud.js | 265 +++ SunSpider/tests/string-unpack-code.js | 68 + SunSpider/tests/string-validate-input.js | 89 + 42 files changed, 7206 insertions(+) create mode 100644 SunSpider/TODO create mode 100644 SunSpider/UNCOVERED create mode 100644 SunSpider/hosted/sunspider-driver.html create mode 100644 SunSpider/hosted/sunspider-record-result.js create mode 100644 SunSpider/hosted/sunspider-results.html create mode 100644 SunSpider/hosted/sunspider.css create mode 100644 SunSpider/hosted/sunspider.html create mode 100755 SunSpider/make-hosted create mode 100644 SunSpider/resources/TEMPLATE.html create mode 100644 SunSpider/resources/sunspider-analyze-results.js create mode 100644 SunSpider/resources/sunspider-compare-results.js create mode 100644 SunSpider/resources/sunspider-standalone-compare.js create mode 100644 SunSpider/resources/sunspider-standalone-driver.js create mode 100755 SunSpider/sunspider create mode 100755 SunSpider/sunspider-compare-results create mode 100644 SunSpider/tests/3d-cube.js create mode 100644 SunSpider/tests/3d-morph.js create mode 100644 SunSpider/tests/3d-raytrace.js create mode 100644 SunSpider/tests/LIST create mode 100644 SunSpider/tests/access-binary-trees.js create mode 100644 SunSpider/tests/access-fannkuch.js create mode 100644 SunSpider/tests/access-nbody.js create mode 100644 SunSpider/tests/access-nsieve.js create mode 100644 SunSpider/tests/bitops-3bit-bits-in-byte.js create mode 100644 SunSpider/tests/bitops-bits-in-byte.js create mode 100644 SunSpider/tests/bitops-bitwise-and.js create mode 100644 SunSpider/tests/bitops-nsieve-bits.js create mode 100644 SunSpider/tests/controlflow-recursive.js create mode 100644 SunSpider/tests/crypto-aes.js create mode 100644 SunSpider/tests/crypto-md5.js create mode 100644 SunSpider/tests/crypto-sha1.js create mode 100644 SunSpider/tests/date-format-tofte.js create mode 100644 SunSpider/tests/date-format-xparb.js create mode 100644 SunSpider/tests/math-cordic.js create mode 100644 SunSpider/tests/math-partial-sums.js create mode 100644 SunSpider/tests/math-spectral-norm.js create mode 100644 SunSpider/tests/regexp-dna.js create mode 100644 SunSpider/tests/string-base64.js create mode 100644 SunSpider/tests/string-fasta.js create mode 100644 SunSpider/tests/string-tagcloud.js create mode 100644 SunSpider/tests/string-unpack-code.js create mode 100644 SunSpider/tests/string-validate-input.js (limited to 'SunSpider') diff --git a/SunSpider/TODO b/SunSpider/TODO new file mode 100644 index 0000000..fee4bc0 --- /dev/null +++ b/SunSpider/TODO @@ -0,0 +1,70 @@ + +* Add more test cases. Categories we'd like to cover (with reasonably + real-world tests, preferably not microbenchmarks) include: + + (X marks the ones that are fairly well covered now). + + X math (general) + X bitops + X 3-d (the math bits) + - crypto / encoding + X string processing + - regexps + - date processing + - array processing + - control flow + - function calls / recursion + - object access (unclear if it is possible to make a realistic + benchmark that isolates this) + + I'd specifically like to add all the computer language shootout + tests that Mozilla is using. + +* Normalize tests. Most of the test cases available have a repeat + count of some sort, so the time they take can be tuned. The tests + should be tuned so that each category contributes about the same + total, and so each test in each category contributes about the same + amount. The question is, what implementation should be the baseline? + My current thought is to either pick some specific browser on a + specific platform (IE 7 or Firefox 2 perhaps), or try to target the + average that some set of same-generation release browsers get on + each test. The latter is more work. IE7 is probably a reasonable + normalization target since it is the latest version of the most + popular browser, so results on this benchmark will tell you how much + you have to gain or lose by using a different browser. + +* Instead of using the standard error, the correct way to calculate + a 95% confidence interval for a small sample is the t-test. + . Basically this involves + using values from a 2-tailed t-distribution table instead of 1.96 to + multiply by the error function, a table is available at + + +* Add support to compare two different engines (or two builds of the + same engine) interleaved. + +* Add support to compare two existing sets of saved results. + +* Allow repeat count to be controlled from the browser-hosted version + and the WebKitTools wrapper script. + +* Add support to run only a subset of the tests (both command-line and + web versions). + +* Add a profile mode for the command-line version that runs the tests + repeatedly in the same command-line interpreter instance, for ease + of profiling. + +* Make the browser-hosted version prettier, both in general design and + maybe using bar graphs for the output. + +* Make it possible to track change over time and generate a graph per + result showing result and error bar for each version. + +* Hook up to automated testing / buildbot infrastructure. + +* Possibly... add the ability to download iBench from its original + server, pull out the JS test content, preprocess it, and add it as a + category to the benchmark. + +* Profit. diff --git a/SunSpider/UNCOVERED b/SunSpider/UNCOVERED new file mode 100644 index 0000000..2a34572 --- /dev/null +++ b/SunSpider/UNCOVERED @@ -0,0 +1,99 @@ + +The following language features are not covered: + +Operators: + +>>>= +^= +%= +in +prefix -- +>>= +delete +void +instanceof + + +statements: + +with +switch + + +core language feaures: + +getters / setters +closure data access +heavy use of first-class functions + +Builtins: + +String.search + +Number.toFixed +Number.toExponential +Number.toPrecision + +RegExp.exec +RegExp custom properties + +Function.apply +Function.call + +parseInt +parseFloat +escape +unescape +decodeURI +encodeURI + + +Date.toDateString +Date.toTimeString +Date.getUTCFullYear +Date.getUTCMonth +Date.getUTCDate +Date.getUTCDay +Date.getUTCSeconds +Date.getMilliseconds +Date.getUTCMilliseconds +Date.set* + + +Math.E +Math.LN2 +Math.LN10 +Math.LOG2E +Math.LOG10E +Math.SQRT1_2 +Math.SQRT2 +Math.acos +Math.asin +Math.atan +Math.atan2 +Math.exp +Math.min +Math.tan + +Object.hasOwnProperty +Object.propertyIsEnumerable +Object.isPrototypeOf + + +Array.concat +Array.join +Array.pop +Array.push +Array.reverse +Array.shift +Array.slice +Array.sort +Array.splice +Array.unshift +Array.every +Array.forEach +Array.some +Array.indexOf +Array.lastIndexOf +Array.filter +Array.map diff --git a/SunSpider/hosted/sunspider-driver.html b/SunSpider/hosted/sunspider-driver.html new file mode 100644 index 0000000..16fbca9 --- /dev/null +++ b/SunSpider/hosted/sunspider-driver.html @@ -0,0 +1,96 @@ + + + + + +SunSpider JavaScript Benchmark (In Progress...) + + + + + +

SunSpider JavaScript Benchmark (In Progress...)

+ + + + + + + + diff --git a/SunSpider/hosted/sunspider-record-result.js b/SunSpider/hosted/sunspider-record-result.js new file mode 100644 index 0000000..f86749a --- /dev/null +++ b/SunSpider/hosted/sunspider-record-result.js @@ -0,0 +1,31 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +function record(time) { + document.getElementById("console").innerHTML = time + "ms"; + if (window.parent) { + parent.recordResult(time); + } +} diff --git a/SunSpider/hosted/sunspider-results.html b/SunSpider/hosted/sunspider-results.html new file mode 100644 index 0000000..cc74938 --- /dev/null +++ b/SunSpider/hosted/sunspider-results.html @@ -0,0 +1,91 @@ + + + + + +SunSpider JavaScript Benchmark Results + + + + +

SunSpider JavaScript Benchmark Results

+ +

Run Again

+ +


+(You can bookmark this results URL for later comparison.)

+ +
To compare to another run, paste a saved result URL in the text field below and press enter:
+
+
+ +
+
+ + + + + + + + + + + + + diff --git a/SunSpider/hosted/sunspider.css b/SunSpider/hosted/sunspider.css new file mode 100644 index 0000000..7a17979 --- /dev/null +++ b/SunSpider/hosted/sunspider.css @@ -0,0 +1,31 @@ + +body { font-family: sans-serif; + margin: 20px; + background-color: #D9D5A1; + color: #1B0636 } + +h2 { background-color: #4E8AB9; + margin: -20px -20px 0px -20px; + padding: 30px 20px 30px 20px; + color: yellow; + border-bottom: 2px solid #360D6B; + zoom: 1.0 /* I CAN HAS LAYOUT? (ie hack) */ } + +dt { font-weight: bold } + +dd { margin-bottom: 1em; margin-top: 0.5em } + +:link { color: #1363A1 } +:visited { color: #5113A1 } + +#testframe { margin-top: 20px; + width: 80%; + height: 500px; + border: 2px solid #360D6B } + +#logo { float: left; + position: relative; + bottom: 0.33em; + padding-right: 20px; + margin-bottom: -40px; + font-size: 3em } diff --git a/SunSpider/hosted/sunspider.html b/SunSpider/hosted/sunspider.html new file mode 100644 index 0000000..f7dfd42 --- /dev/null +++ b/SunSpider/hosted/sunspider.html @@ -0,0 +1,78 @@ + + + + + + +SunSpider JavaScript Benchmark + + + + + +

SunSpider JavaScript Benchmark

+ +

This is SunSpider, a JavaScript benchmark. This benchmark tests the +core JavaScript language only, not the DOM or other browser APIs. It +is designed to compare different versions of the same browser, and +different browsers to each other. Unlike many widely available +JavaScript benchmarks, this test is:

+ +
+
Real World
+
This test mostly avoids microbenchmarks, and tries to focus on +the kinds of actual problems developers solve with JavaScript today, +and the problems they may want to tackle in the future as the language +gets faster. This includes tests to generate a tagcloud from JSON +input, a 3D raytracer, cryptography tests, code decompression, and +many more examples. There are a few microbenchmarkish things, but they +mostly represent real performance problems that developers have +encountered.
+ +
Balanced
+
This test is balanced between different areas of the language and +different types of code. It's not all math, all string processing, or +all timing simple loops. In addition to having tests in many +categories, the individual tests were balanced to take similar amounts +of time on currently shipping versions of popular browsers.
+ +
Statistically Sound
+
One of the challenges of benchmarking is knowing how much noise +you have in your measurements. This benchmark runs each test multiple +times and determines an error range (technically, a 95% confidence +interval). In addition, in comparison mode it tells you if you have +enough data to determine if the difference is statistically +significant.
+ +
+ +

Start Now!
+(When you run the benchmark, be patient - it loops through all of the +test cases five times and can take a minute or longer to complete.)

+ + + + diff --git a/SunSpider/make-hosted b/SunSpider/make-hosted new file mode 100755 index 0000000..303de56 --- /dev/null +++ b/SunSpider/make-hosted @@ -0,0 +1,77 @@ +#!/usr/bin/perl -w + +# Copyright (C) 2007 Apple Inc. All rights reserved. +# +# Redistribution and use in source and binary forms, with or without +# modification, are permitted provided that the following conditions +# are met: +# 1. Redistributions of source code must retain the above copyright +# notice, this list of conditions and the following disclaimer. +# 2. Redistributions in binary form must reproduce the above copyright +# notice, this list of conditions and the following disclaimer in the +# documentation and/or other materials provided with the distribution. +# +# THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY +# EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +# PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR +# CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, +# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, +# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR +# PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY +# OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT +# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE +# OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + +use strict; + +open TEMPLATE, " }; +close TEMPLATE; + +my @tests = (); +my @categories = (); +my %uniqueCategories = (); + +open TESTLIST, "<./tests/LIST"; +while () { + chomp; + next unless $_; + push @tests, $_; + my $category = $_; + $category =~ s/-.*//; + if (!$uniqueCategories{$category}) { + push @categories, $category; + $uniqueCategories{$category} = $category; + } +} +close TESTLIST; + +for my $test (@tests) { + my $name = "${test}"; + + open SCRIPT, " }; + close SCRIPT; + + my $output = $template; + $output =~ s/\@NAME\@/${name}/g; + $output =~ s/\@SCRIPT\@/${script}/g; + + open OUTPUT, ">hosted/${test}.html"; + print OUTPUT $output; + close OUTPUT; +} + + +my $prefix = "var tests = [ " . join(", ", map { '"' . $_ . '"' } @tests) . " ];\n"; +$prefix .= "var categories = [ " . join(", ", map { '"' . $_ . '"' } @categories) . " ];\n"; + +open PREFIX, ">hosted/sunspider-test-prefix.js"; +print PREFIX $prefix; +close PREFIX; + +system("cp resources/sunspider-analyze-results.js hosted"); +system("cp resources/sunspider-compare-results.js hosted"); + +print "hosted/sunspider.html is ready to use.\n"; diff --git a/SunSpider/resources/TEMPLATE.html b/SunSpider/resources/TEMPLATE.html new file mode 100644 index 0000000..926150d --- /dev/null +++ b/SunSpider/resources/TEMPLATE.html @@ -0,0 +1,50 @@ + + + + +SunSpider @NAME@ + + + + +

@NAME@

+
+
+ + + + + + diff --git a/SunSpider/resources/sunspider-analyze-results.js b/SunSpider/resources/sunspider-analyze-results.js new file mode 100644 index 0000000..d849f59 --- /dev/null +++ b/SunSpider/resources/sunspider-analyze-results.js @@ -0,0 +1,268 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +var count = output.length; + +var itemTotals = {}; +itemTotals.length = count; + +var total = 0; +var categoryTotals = {}; +var testTotalsByCategory = {}; + +var mean = 0; +var categoryMeans = {}; +var testMeansByCategory = {}; + +var stdDev = 0; +var categoryStdDevs = {}; +var testStdDevsByCategory = {}; + +var stdErr = 0; +var categoryStdErrs = {}; +var testStdErrsByCategory = {}; + +function initialize() +{ + itemTotals = {total: []}; + + for (var i = 0; i < categories.length; i++) { + var category = categories[i]; + itemTotals[category] = []; + categoryTotals[category] = 0; + testTotalsByCategory[category] = {}; + categoryMeans[category] = 0; + testMeansByCategory[category] = {}; + categoryStdDevs[category] = 0; + testStdDevsByCategory[category] = {}; + categoryStdErrs[category] = 0; + testStdErrsByCategory[category] = {}; + } + + for (var i = 0; i < tests.length; i++) { + var test = tests[i]; + itemTotals[test] = []; + var category = test.replace(/-.*/, ""); + testTotalsByCategory[category][test] = 0; + testMeansByCategory[category][test] = 0; + testStdDevsByCategory[category][test] = 0; + testStdErrsByCategory[category][test] = 0; + } + + for (var i = 0; i < count; i++) { + itemTotals["total"][i] = 0; + for (var category in categoryTotals) { + itemTotals[category][i] = 0; + for (var test in testTotalsByCategory[category]) { + itemTotals[test][i] = 0; + } + } + } +} + +function computeItemTotals() +{ + for (var i = 0; i < output.length; i++) { + var result = output[i]; + for (var test in result) { + var time = result[test]; + var category = test.replace(/-.*/, ""); + itemTotals["total"][i] += time; + itemTotals[category][i] += time; + itemTotals[test][i] += time; + } + } +} + +function computeTotals() +{ + for (var i = 0; i < output.length; i++) { + var result = output[i]; + for (var test in result) { + var time = result[test]; + var category = test.replace(/-.*/, ""); + total += time; + categoryTotals[category] += time; + testTotalsByCategory[category][test] += time; + } + } +} + +function computeMeans() +{ + mean = total / count; + for (var category in categoryTotals) { + categoryMeans[category] = categoryTotals[category] / count; + for (var test in testTotalsByCategory[category]) { + testMeansByCategory[category][test] = testTotalsByCategory[category][test] / count; + } + } +} + +function standardDeviation(mean, items) +{ + var deltaSquaredSum = 0; + for (var i = 0; i < items.length; i++) { + var delta = items[i] - mean; + deltaSquaredSum += delta * delta; + } + variance = deltaSquaredSum / (items.length - 1); + return Math.sqrt(variance); +} + +function computeStdDevs() +{ + stdDev = standardDeviation(mean, itemTotals["total"]); + for (var category in categoryStdDevs) { + categoryStdDevs[category] = standardDeviation(categoryMeans[category], itemTotals[category]); + } + for (var category in categoryStdDevs) { + for (var test in testStdDevsByCategory[category]) { + testStdDevsByCategory[category][test] = standardDeviation(testMeansByCategory[category][test], itemTotals[test]); + } + } +} + +function computeStdErrors() +{ + var sqrtCount = Math.sqrt(count); + + stdErr = stdDev / sqrtCount; + for (var category in categoryStdErrs) { + categoryStdErrs[category] = categoryStdDevs[category] / sqrtCount; + } + for (var category in categoryStdDevs) { + for (var test in testStdErrsByCategory[category]) { + testStdErrsByCategory[category][test] = testStdDevsByCategory[category][test] / sqrtCount; + } + } + +} + +var tDistribution = [NaN, NaN, 12.71, 4.30, 3.18, 2.78, 2.57, 2.45, 2.36, 2.31, 2.26, 2.23, 2.20, 2.18, 2.16, 2.14, 2.13, 2.12, 2.11, 2.10, 2.09, 2.09, 2.08, 2.07, 2.07, 2.06, 2.06, 2.06, 2.05, 2.05, 2.05, 2.04, 2.04, 2.04, 2.03, 2.03, 2.03, 2.03, 2.03, 2.02, 2.02, 2.02, 2.02, 2.02, 2.02, 2.02, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.96]; +var tMax = tDistribution.length; +var tLimit = 1.96; + +function tDist(n) +{ + if (n > tMax) + return tLimit; + return tDistribution[n]; +} + + +function formatResult(meanWidth, mean, stdErr, n) +{ + var meanString = mean.toFixed(1).toString(); + while (meanString.length < meanWidth) { + meanString = " " + meanString; + } + + if (n == 1) + return meanString + "ms"; + + return meanString + "ms +/- " + ((tDist(n) * stdErr / mean) * 100).toFixed(1) + "%"; +} + +function computeLabelWidth() +{ + var width = "Total".length; + for (var category in categoryMeans) { + if (category.length + 2 > width) + width = category.length + 2; + } + for (var i = 0; i < tests.length; i++) { + var shortName = tests[i].replace(/^[^-]*-/, ""); + if (shortName.length + 4 > width) + width = shortName.length + 4; + } + + return width; +} + +function computeMeanWidth() +{ + var width = mean.toFixed(1).toString().length; + for (var category in categoryMeans) { + var candidate = categoryMeans[category].toFixed(2).toString().length; + if (candidate > width) + width = candidate; + for (var test in testMeansByCategory[category]) { + var candidate = testMeansByCategory[category][test].toFixed(2).toString().length; + if (candidate > width) + width = candidate; + } + } + + return width; +} + +function resultLine(labelWidth, indent, label, meanWidth, mean, stdErr) +{ + var result = ""; + for (i = 0; i < indent; i++) { + result += " "; + } + + result += label + ": "; + + for (i = 0; i < (labelWidth - (label.length + indent)); i++) { + result += " "; + } + + return result + formatResult(meanWidth, mean, stdErr, count); +} + +function printOutput() +{ + var labelWidth = computeLabelWidth(); + var meanWidth = computeMeanWidth(); + + print("\n"); + print("============================================"); + if (count == 1) + print("RESULTS"); + else + print("RESULTS (means and 95% confidence intervals)"); + print("--------------------------------------------"); + print(resultLine(labelWidth, 0, "Total", meanWidth, mean, stdErr)); + print("--------------------------------------------"); + for (var category in categoryMeans) { + print(""); + print(resultLine(labelWidth, 2, category, meanWidth, categoryMeans[category], categoryStdErrs[category])); + for (var test in testMeansByCategory[category]) { + var shortName = test.replace(/^[^-]*-/, ""); + print(resultLine(labelWidth, 4, shortName, meanWidth, testMeansByCategory[category][test], testStdErrsByCategory[category][test])); + } + } +} + +initialize(); +computeItemTotals(); +computeTotals(); +computeMeans(); +computeStdDevs(); +computeStdErrors(); +printOutput(); diff --git a/SunSpider/resources/sunspider-compare-results.js b/SunSpider/resources/sunspider-compare-results.js new file mode 100644 index 0000000..887b8db --- /dev/null +++ b/SunSpider/resources/sunspider-compare-results.js @@ -0,0 +1,380 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +function sunspiderCompareResults(output1, output2) +{ + var count1 = output1.length; + var count2 = output2.length; + + var itemTotals1 = {}; + itemTotals1.length = count1; + + var total1 = 0; + var categoryTotals1 = {}; + var testTotalsByCategory1 = {}; + + var mean1 = 0; + var categoryMeans1 = {}; + var testMeansByCategory1 = {}; + + var stdDev1 = 0; + var categoryStdDevs1 = {}; + var testStdDevsByCategory1 = {}; + + var stdErr1 = 0; + var categoryStdErrs1 = {}; + var testStdErrsByCategory1 = {}; + + var itemTotals2 = {}; + itemTotals2.length = count2; + + var total2 = 0; + var categoryTotals2 = {}; + var testTotalsByCategory2 = {}; + + var mean2 = 0; + var categoryMeans2 = {}; + var testMeansByCategory2 = {}; + + var stdDev2 = 0; + var categoryStdDevs2 = {}; + var testStdDevsByCategory2 = {}; + + var stdErr2 = 0; + var categoryStdErrs2 = {}; + var testStdErrsByCategory2 = {}; + + function initialize() + { + itemTotals1 = {total: []}; + + for (var i = 0; i < categories.length; i++) { + var category = categories[i]; + itemTotals1[category] = []; + categoryTotals1[category] = 0; + testTotalsByCategory1[category] = {}; + categoryMeans1[category] = 0; + testMeansByCategory1[category] = {}; + categoryStdDevs1[category] = 0; + testStdDevsByCategory1[category] = {}; + categoryStdErrs1[category] = 0; + testStdErrsByCategory1[category] = {}; + } + + for (var i = 0; i < tests.length; i++) { + var test = tests[i]; + itemTotals1[test] = []; + var category = test.replace(/-.*/, ""); + testTotalsByCategory1[category][test] = 0; + testMeansByCategory1[category][test] = 0; + testStdDevsByCategory1[category][test] = 0; + testStdErrsByCategory1[category][test] = 0; + } + + for (var i = 0; i < count1; i++) { + itemTotals1["total"][i] = 0; + for (var category in categoryTotals1) { + itemTotals1[category][i] = 0; + for (var test in testTotalsByCategory1[category]) { + itemTotals1[test][i] = 0; + } + } + } + + itemTotals2 = {total: []}; + + for (var i = 0; i < categories.length; i++) { + var category = categories[i]; + itemTotals2[category] = []; + categoryTotals2[category] = 0; + testTotalsByCategory2[category] = {}; + categoryMeans2[category] = 0; + testMeansByCategory2[category] = {}; + categoryStdDevs2[category] = 0; + testStdDevsByCategory2[category] = {}; + categoryStdErrs2[category] = 0; + testStdErrsByCategory2[category] = {}; + } + + for (var i = 0; i < tests.length; i++) { + var test = tests[i]; + itemTotals2[test] = []; + var category = test.replace(/-.*/, ""); + testTotalsByCategory2[category][test] = 0; + testMeansByCategory2[category][test] = 0; + testStdDevsByCategory2[category][test] = 0; + testStdErrsByCategory2[category][test] = 0; + } + + for (var i = 0; i < count2; i++) { + itemTotals2["total"][i] = 0; + for (var category in categoryTotals2) { + itemTotals2[category][i] = 0; + for (var test in testTotalsByCategory2[category]) { + itemTotals2[test][i] = 0; + } + } + } + + } + + function computeItemTotals(output, itemTotals) + { + for (var i = 0; i < output.length; i++) { + var result = output[i]; + for (var test in result) { + var time = result[test]; + var category = test.replace(/-.*/, ""); + itemTotals["total"][i] += time; + itemTotals[category][i] += time; + itemTotals[test][i] += time; + } + } + } + + function computeTotals(output, categoryTotals, testTotalsByCategory) + { + var total = 0; + + for (var i = 0; i < output.length; i++) { + var result = output[i]; + for (var test in result) { + var time = result[test]; + var category = test.replace(/-.*/, ""); + total += time; + categoryTotals[category] += time; + testTotalsByCategory[category][test] += time; + } + } + + return total; + } + + function computeMeans(count, total, categoryTotals, categoryMeans, testTotalsByCategory, testMeansByCategory) + { + var mean = total / count; + for (var category in categoryTotals) { + categoryMeans[category] = categoryTotals[category] / count; + for (var test in testTotalsByCategory[category]) { + testMeansByCategory[category][test] = testTotalsByCategory[category][test] / count; + } + } + return mean; + } + + function standardDeviation(mean, items) + { + var deltaSquaredSum = 0; + for (var i = 0; i < items.length; i++) { + var delta = items[i] - mean; + deltaSquaredSum += delta * delta; + } + variance = deltaSquaredSum / (items.length - 1); + return Math.sqrt(variance); + } + + function computeStdDevs(mean, itemTotals, categoryStdDevs, categoryMeans, testStdDevsByCategory, testMeansByCategory) + { + var stdDev = standardDeviation(mean, itemTotals["total"]); + for (var category in categoryStdDevs) { + categoryStdDevs[category] = standardDeviation(categoryMeans[category], itemTotals[category]); + } + for (var category in categoryStdDevs) { + for (var test in testStdDevsByCategory[category]) { + testStdDevsByCategory[category][test] = standardDeviation(testMeansByCategory[category][test], itemTotals[test]); + } + } + return stdDev; + } + + function computeStdErrors(count, stdDev, categoryStdErrs, categoryStdDevs, testStdErrsByCategory, testStdDevsByCategory) + { + var sqrtCount = Math.sqrt(count); + + var stdErr = stdDev / sqrtCount; + for (var category in categoryStdErrs) { + categoryStdErrs[category] = categoryStdDevs[category] / sqrtCount; + } + for (var category in categoryStdDevs) { + for (var test in testStdErrsByCategory[category]) { + testStdErrsByCategory[category][test] = testStdDevsByCategory[category][test] / sqrtCount; + } + } + + return stdErr; + } + + var tDistribution = [NaN, NaN, 12.71, 4.30, 3.18, 2.78, 2.57, 2.45, 2.36, 2.31, 2.26, 2.23, 2.20, 2.18, 2.16, 2.14, 2.13, 2.12, 2.11, 2.10, 2.09, 2.09, 2.08, 2.07, 2.07, 2.06, 2.06, 2.06, 2.05, 2.05, 2.05, 2.04, 2.04, 2.04, 2.03, 2.03, 2.03, 2.03, 2.03, 2.02, 2.02, 2.02, 2.02, 2.02, 2.02, 2.02, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.01, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 2.00, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.99, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.98, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.97, 1.96]; + var tMax = tDistribution.length; + var tLimit = 1.96; + + function tDist(n) + { + if (n > tMax) + return tLimit; + return tDistribution[n]; + } + + + function formatMean(meanWidth, mean, stdErr, count) + { + var meanString = mean.toFixed(1).toString(); + while (meanString.length < meanWidth) { + meanString = " " + meanString; + } + + var error = "+/- " + ((tDist(count) * stdErr / mean) * 100).toFixed(1) + "% "; + + return meanString + "ms " + error; + } + + function computeLabelWidth() + { + var width = "Total".length; + for (var category in categoryMeans1) { + if (category.length + 2 > width) + width = category.length + 2; + } + for (var i = 0; i < tests.length; i++) { + var shortName = tests[i].replace(/^[^-]*-/, ""); + if (shortName.length + 4 > width) + width = shortName.length + 4; + } + + return width; + } + + function computeMeanWidth(mean, categoryMeans, testMeansByCategory) + { + var width = mean.toFixed(1).toString().length; + for (var category in categoryMeans) { + var candidate = categoryMeans[category].toFixed(1).toString().length; + if (candidate > width) + width = candidate; + for (var test in testMeansByCategory[category]) { + var candidate = testMeansByCategory[category][test].toFixed(1).toString().length; + if (candidate > width) + width = candidate; + } + } + + return width; + } + + function pad(str, n) + { + while (str.length < n) { + str += " "; + } + return str; + } + + function resultLine(labelWidth, indent, label, meanWidth1, mean1, stdErr1, meanWidth2, mean2, stdErr2) + { + result = pad("", indent); + result += label + ": "; + result = pad(result, labelWidth + 2); + + var t = (mean1 - mean2) / (Math.sqrt((stdErr1 * stdErr1) + (stdErr1 * stdErr2))); + var df = count1 + count2 - 2; + + var statisticallySignificant = (Math.abs(t) > tDist(df+1)); + var diff = mean2 - mean1; + var percentage = 100 * diff / mean1; + var isFaster = diff < 0; + var probablySame = (percentage < 0.1) && !statisticallySignificant; + var ratio = isFaster ? (mean1 / mean2) : (mean2 / mean1); + var fixedRatio = (ratio < 1.2) ? ratio.toFixed(3).toString() : ((ratio < 10) ? ratio.toFixed(2).toString() : ratio.toFixed(1).toString()); + var formattedRatio = isFaster ? fixedRatio + "x as fast" : "*" + fixedRatio + "x as slow*"; + + var diffSummary; + var diffDetail; + + if (probablySame) { + diffSummary = "-"; + diffDetail = ""; + } else if (!statisticallySignificant) { + diffSummary = "??"; + diffDetail = " not conclusive: might be " + formattedRatio; + } else { + diffSummary = formattedRatio; + diffDetail = " significant"; + } + + return result + pad(diffSummary, 18) + formatMean(meanWidth1, mean1, stdErr1, count1) + " " + formatMean(meanWidth2, mean2, stdErr2, count2) + diffDetail; + } + + function printOutput() + { + var labelWidth = computeLabelWidth(); + var meanWidth1 = computeMeanWidth(mean1, categoryMeans1, testMeansByCategory1); + var meanWidth2 = computeMeanWidth(mean2, categoryMeans2, testMeansByCategory2); + + print("\n"); + var header = "TEST"; + while (header.length < labelWidth) + header += " "; + header += " COMPARISON FROM TO DETAILS"; + print(header); + print(""); + print("============================================================================="); + print(""); + print(resultLine(labelWidth, 0, "** TOTAL **", meanWidth1, mean1, stdErr1, meanWidth2, mean2, stdErr2)); + print(""); + print("============================================================================="); + + for (var category in categoryMeans1) { + print(""); + print(resultLine(labelWidth, 2, category, + meanWidth1, categoryMeans1[category], categoryStdErrs1[category], + meanWidth2, categoryMeans2[category], categoryStdErrs2[category])); + for (var test in testMeansByCategory1[category]) { + var shortName = test.replace(/^[^-]*-/, ""); + print(resultLine(labelWidth, 4, shortName, + meanWidth1, testMeansByCategory1[category][test], testStdErrsByCategory1[category][test], + meanWidth2, testMeansByCategory2[category][test], testStdErrsByCategory2[category][test])); + } + } + } + + initialize(); + + computeItemTotals(output1, itemTotals1); + computeItemTotals(output2, itemTotals2); + + total1 = computeTotals(output1, categoryTotals1, testTotalsByCategory1); + total2 = computeTotals(output2, categoryTotals2, testTotalsByCategory2); + + mean1 = computeMeans(count1, total1, categoryTotals1, categoryMeans1, testTotalsByCategory1, testMeansByCategory1); + mean2 = computeMeans(count2, total2, categoryTotals2, categoryMeans2, testTotalsByCategory2, testMeansByCategory2); + + stdDev1 = computeStdDevs(mean1, itemTotals1, categoryStdDevs1, categoryMeans1, testStdDevsByCategory1, testMeansByCategory1); + stdDev2 = computeStdDevs(mean2, itemTotals2, categoryStdDevs2, categoryMeans2, testStdDevsByCategory2, testMeansByCategory2); + + stdErr1 = computeStdErrors(count1, stdDev1, categoryStdErrs1, categoryStdDevs1, testStdErrsByCategory1, testStdDevsByCategory1); + stdErr2 = computeStdErrors(count2, stdDev2, categoryStdErrs2, categoryStdDevs2, testStdErrsByCategory2, testStdDevsByCategory2); + + printOutput(); +} diff --git a/SunSpider/resources/sunspider-standalone-compare.js b/SunSpider/resources/sunspider-standalone-compare.js new file mode 100644 index 0000000..e82c155 --- /dev/null +++ b/SunSpider/resources/sunspider-standalone-compare.js @@ -0,0 +1,26 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +sunspiderCompareResults(output1, output2); diff --git a/SunSpider/resources/sunspider-standalone-driver.js b/SunSpider/resources/sunspider-standalone-driver.js new file mode 100644 index 0000000..22aeb61 --- /dev/null +++ b/SunSpider/resources/sunspider-standalone-driver.js @@ -0,0 +1,53 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +var results = new Array(); + +var time = 0; +var times = []; +times.length = tests.length; + +for (var j = 0; j < tests.length; j++) { + var testName = "tests/" + tests[j] + ".js"; + var startTime = new Date; + load(testName); + times[j] = new Date() - startTime; + gc(); +} + +function recordResults(tests, times) +{ + var output = "{\n"; + + for (j = 0; j < tests.length; j++) { + output += ' "' + tests[j] + '": ' + times[j] + ',\n'; + } + output = output.substring(0, output.length - 2) + "\n"; + + output += "}"; + print(output); +} + +recordResults(tests, times); diff --git a/SunSpider/sunspider b/SunSpider/sunspider new file mode 100755 index 0000000..da8634f --- /dev/null +++ b/SunSpider/sunspider @@ -0,0 +1,214 @@ +#!/usr/bin/perl -w + +# Copyright (C) 2007 Apple Inc. All rights reserved. +# Copyright (C) 2007 Eric Seidel +# +# Redistribution and use in source and binary forms, with or without +# modification, are permitted provided that the following conditions +# are met: +# 1. Redistributions of source code must retain the above copyright +# notice, this list of conditions and the following disclaimer. +# 2. Redistributions in binary form must reproduce the above copyright +# notice, this list of conditions and the following disclaimer in the +# documentation and/or other materials provided with the distribution. +# +# THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY +# EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +# PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR +# CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, +# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, +# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR +# PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY +# OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT +# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE +# OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + +use strict; +use Getopt::Long; +use File::Basename; +use File::Spec; +use Cwd; +use POSIX qw(strftime); + +my $showHelp = 0; +my $runShark = 0; +my $runShark20 = 0; +my $runSharkCache = 0; +my $jsShellPath; +my $setBaseline = 0; +my $testsPattern; +my $testRuns = 10; + +my $programName = basename($0); +my $usage = < \$testRuns, + 'set-baseline' => \$setBaseline, + 'shell=s' => \$jsShellPath, + 'shark' => \$runShark, + 'shark20' => \$runShark20, + 'shark-cache' => \$runSharkCache, + 'tests=s' => \$testsPattern, + 'help' => \$showHelp); + +$runShark = 1 if $runSharkCache; +$runShark = 20 if $runShark20; +$testRuns = 1 if $runShark; +if ($runShark && ! -x "/usr/bin/shark") { + die "Please install CHUD tools from http://developer.apple.com/tools/download/\n"; +} + +my $sharkCacheProfileIndex = 0; +if ($runSharkCache) { + my $sharkProfileList = `shark -l 2>&1`; + for my $profile (split(/\n/, $sharkProfileList)) { + $profile =~ /(\d+) - (.+)/; + next unless (defined $1); + my $profileIndex = $1; + my $profileName = $2; + if ($profileName =~ /L2 Cache/) { + $sharkCacheProfileIndex = $profileIndex; + print "Using Shark L2 Cache Miss Profile: " . $profile . "\n"; + last; + } + } + die "Failed to find L2 Cache Miss Profile for --shark-cache\n" unless ($sharkCacheProfileIndex); +} + +if (!$jsShellPath || $showHelp) { + print STDERR $usage; + exit 1; +} + +sub dumpToFile($$) +{ + my ($contents, $path) = @_; + open FILE, ">", $path or die "Failed to open $path"; + print FILE $contents; + close FILE; +} + +my @tests = (); +my @categories = (); +my %uniqueCategories = (); + +sub loadTestsList() +{ + open TESTLIST, "<", "tests/LIST" or die "Can't find ./tests/LIST"; + while () { + chomp; + next unless !$testsPattern || /$testsPattern/; + + push @tests, $_; + my $category = $_; + $category =~ s/-.*//; + if (!$uniqueCategories{$category}) { + push @categories, $category; + $uniqueCategories{$category} = $category; + } + } + close TESTLIST; +} + +my $timeString = strftime "%Y-%m-%d-%H.%M.%S", localtime $^T; +my $prefixFile = "tmp/sunspider-test-prefix.js"; +my $resultsFile = "tmp/sunspider-results-$timeString.js"; + +sub writePrefixFile() +{ + my $prefix = "var tests = [ " . join(", ", map { '"' . $_ . '"' } @tests) . " ];\n"; + $prefix .= "var categories = [ " . join(", ", map { '"' . $_ . '"' } @categories) . " ];\n"; + + mkdir "tmp"; + dumpToFile($prefix, $prefixFile); +} + +sub runTestsOnce($) +{ + my ($useShark) = @_; + my $shellArgs = "-f $prefixFile -f resources/sunspider-standalone-driver.js 2> /dev/null"; + my $output; + if ($useShark) { + my $intervalArg = $useShark == 20 ? "-I 20u" : ""; + my $cacheArg = $runSharkCache ? "-c $sharkCacheProfileIndex" : ""; + $output = `shark $intervalArg $cacheArg -i -1-q "$jsShellPath" $shellArgs`; + } else { + $output = `"$jsShellPath" $shellArgs | grep -v break`; + } + return $output; +} + +sub newestFile($$) +{ + my ($dir, $pattern) = @_; + + my $newestAge; + my $newestFile = ""; + opendir DIR, $dir or die; + for my $file (readdir DIR) { + if ($file =~ $pattern) { + my $age = -M "$dir/$file"; + if (!defined $newestAge || $age < $newestAge) { + $newestFile = $file; + $newestAge = $age; + } + } + } + closedir DIR; + + return "$dir/$newestFile"; +} + +loadTestsList(); +if ($testsPattern) { + print STDERR "Found " . scalar(@tests) . " tests matching '" . $testsPattern . "'\n"; +} else { + print STDERR "Found " . scalar(@tests) . " tests\n"; +} +die "No tests to run" unless scalar(@tests); +print STDERR "Running SunSpider once for warmup, then " . ($runShark ? "under Shark" : "$testRuns time" . ($testRuns == 1 ? "" : "s")) . "\n"; +writePrefixFile(); + +runTestsOnce(0); +print "Discarded first run.\n"; + +my $result; +my $count = 0; +my @results = (); +my $total = 0; +print "["; +while ($count++ < $testRuns) { + $result = runTestsOnce($runShark); + $result =~ s/\r\n/\n/g; + chomp $result; + push @results, $result; + print $result; + print ",\n" unless ($count == $testRuns); +} +print "]\n"; + +my $output = "var output = [\n" . join(",\n", @results) . "\n];\n"; +dumpToFile($output, $resultsFile); +dumpToFile(File::Spec->rel2abs($resultsFile), "tmp/baseline-filename.txt") if $setBaseline; + +system("$jsShellPath", "-f", $prefixFile, "-f", $resultsFile, "-f", "resources/sunspider-analyze-results.js"); + +if ($runShark) { + my $newestMShark = newestFile(".", qr/\.mshark$/); + if ($newestMShark) { + my $profileFile = "tmp/sunspider-profile-$timeString.mshark"; + rename $newestMShark, $profileFile or die; + exec "/usr/bin/open", $profileFile; + } +} diff --git a/SunSpider/sunspider-compare-results b/SunSpider/sunspider-compare-results new file mode 100755 index 0000000..f23fb24 --- /dev/null +++ b/SunSpider/sunspider-compare-results @@ -0,0 +1,142 @@ +#!/usr/bin/perl -w + +# Copyright (C) 2007 Apple Inc. All rights reserved. +# +# Redistribution and use in source and binary forms, with or without +# modification, are permitted provided that the following conditions +# are met: +# 1. Redistributions of source code must retain the above copyright +# notice, this list of conditions and the following disclaimer. +# 2. Redistributions in binary form must reproduce the above copyright +# notice, this list of conditions and the following disclaimer in the +# documentation and/or other materials provided with the distribution. +# +# THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY +# EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +# PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR +# CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, +# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, +# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR +# PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY +# OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT +# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE +# OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + +use strict; +use Getopt::Long; +use File::Basename; + +my $showHelp = 0; +my $jsShellPath; + +my $programName = basename($0); +my $usage = < \$jsShellPath, + 'help' => \$showHelp); + +if ((scalar @ARGV != 0 && scalar @ARGV != 2) || !$jsShellPath || $showHelp) { + print STDERR $usage; + exit 1; +} + +sub readResultsFile($) +{ + my ($filename) = @_; + open FILE, "<", $filename or die; + my $foundStart = 0; + my $foundOutput = 0; + my $foundEnd = 0; + my $result = ""; + while () { + if (!$foundStart) { + if (/^\[\{$/) { + $foundStart = 1; + $result .= $_; + } elsif (/^var \w+ = \[$/) { + $foundOutput = 1; + } elsif ($foundOutput && /^\{$/) { + $foundOutput = 0; + $foundStart = 1; + $result = "[{\n"; + } + } else { + if (/\];?$/) { + $foundEnd = 1; + chomp; + s/;$//; + $result .= $_; + last; + } else { + $result .= $_; + } + } + } + close FILE; + + die "Cound not find data in ${filename} - needs to start with [{" unless $foundStart; + die "Cound not find data in ${filename} - needs to end with }]" unless $foundEnd; + + return $result; +} + +sub dumpToFile($$) +{ + my ($contents, $path) = @_; + open FILE, ">", $path or die; + print FILE $contents; + close FILE; +} + +sub readFile($) +{ + my ($path) = @_; + open FILE, "<", $path or die; + my $result = ; + close FILE; + return $result; +} + +sub newestFile($$) +{ + my ($dir, $pattern) = @_; + + my $newestAge; + my $newestFile = ""; + opendir DIR, $dir or die; + for my $file (readdir DIR) { + if ($file =~ $pattern) { + my $age = -M "$dir/$file"; + if (!defined $newestAge || $age < $newestAge) { + $newestFile = $file; + $newestAge = $age; + } + } + } + closedir DIR; + + return "$dir/$newestFile"; +} + +my $file1; +my $file2; + +if (scalar @ARGV == 2) { + $file1 = $ARGV[0]; + $file2 = $ARGV[1]; +} else { + $file1 = readFile("tmp/baseline-filename.txt"); + $file2 = newestFile("tmp", qr/sunspider-results-.+\.js$/); +} + +my $output = "var output1 = " . readResultsFile($file1) . ";\n"; +$output .= "var output2 = " . readResultsFile($file2) . ";\n"; + +dumpToFile($output, "tmp/sunspider-comparison-data.js"); + +system($jsShellPath, "-f", "tmp/sunspider-test-prefix.js", "-f", "tmp/sunspider-comparison-data.js", "-f", "resources/sunspider-compare-results.js", "-f", "resources/sunspider-standalone-compare.js"); diff --git a/SunSpider/tests/3d-cube.js b/SunSpider/tests/3d-cube.js new file mode 100644 index 0000000..e2cd6f9 --- /dev/null +++ b/SunSpider/tests/3d-cube.js @@ -0,0 +1,337 @@ +// 3D Cube Rotation +// http://www.speich.net/computer/moztesting/3d.htm +// Created by Simon Speich + +var Q = new Array(); +var MTrans = new Array(); // transformation matrix +var MQube = new Array(); // position information of qube +var I = new Array(); // entity matrix +var Origin = new Object(); +var Testing = new Object(); +var LoopTimer; + +var DisplArea = new Object(); +DisplArea.Width = 300; +DisplArea.Height = 300; + +function DrawLine(From, To) { + var x1 = From.V[0]; + var x2 = To.V[0]; + var y1 = From.V[1]; + var y2 = To.V[1]; + var dx = Math.abs(x2 - x1); + var dy = Math.abs(y2 - y1); + var x = x1; + var y = y1; + var IncX1, IncY1; + var IncX2, IncY2; + var Den; + var Num; + var NumAdd; + var NumPix; + + if (x2 >= x1) { IncX1 = 1; IncX2 = 1; } + else { IncX1 = -1; IncX2 = -1; } + if (y2 >= y1) { IncY1 = 1; IncY2 = 1; } + else { IncY1 = -1; IncY2 = -1; } + if (dx >= dy) { + IncX1 = 0; + IncY2 = 0; + Den = dx; + Num = dx / 2; + NumAdd = dy; + NumPix = dx; + } + else { + IncX2 = 0; + IncY1 = 0; + Den = dy; + Num = dy / 2; + NumAdd = dx; + NumPix = dy; + } + + NumPix = Math.round(Q.LastPx + NumPix); + + var i = Q.LastPx; + for (; i < NumPix; i++) { + Num += NumAdd; + if (Num >= Den) { + Num -= Den; + x += IncX1; + y += IncY1; + } + x += IncX2; + y += IncY2; + } + Q.LastPx = NumPix; +} + +function CalcCross(V0, V1) { + var Cross = new Array(); + Cross[0] = V0[1]*V1[2] - V0[2]*V1[1]; + Cross[1] = V0[2]*V1[0] - V0[0]*V1[2]; + Cross[2] = V0[0]*V1[1] - V0[1]*V1[0]; + return Cross; +} + +function CalcNormal(V0, V1, V2) { + var A = new Array(); var B = new Array(); + for (var i = 0; i < 3; i++) { + A[i] = V0[i] - V1[i]; + B[i] = V2[i] - V1[i]; + } + A = CalcCross(A, B); + var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]); + for (var i = 0; i < 3; i++) A[i] = A[i] / Length; + A[3] = 1; + return A; +} + +function CreateP(X,Y,Z) { + this.V = [X,Y,Z,1]; +} + +// multiplies two matrices +function MMulti(M1, M2) { + var M = [[],[],[],[]]; + var i = 0; + var j = 0; + for (; i < 4; i++) { + j = 0; + for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j]; + } + return M; +} + +//multiplies matrix with vector +function VMulti(M, V) { + var Vect = new Array(); + var i = 0; + for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3]; + return Vect; +} + +function VMulti2(M, V) { + var Vect = new Array(); + var i = 0; + for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2]; + return Vect; +} + +// add to matrices +function MAdd(M1, M2) { + var M = [[],[],[],[]]; + var i = 0; + var j = 0; + for (; i < 4; i++) { + j = 0; + for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j]; + } + return M; +} + +function Translate(M, Dx, Dy, Dz) { + var T = [ + [1,0,0,Dx], + [0,1,0,Dy], + [0,0,1,Dz], + [0,0,0,1] + ]; + return MMulti(T, M); +} + +function RotateX(M, Phi) { + var a = Phi; + a *= Math.PI / 180; + var Cos = Math.cos(a); + var Sin = Math.sin(a); + var R = [ + [1,0,0,0], + [0,Cos,-Sin,0], + [0,Sin,Cos,0], + [0,0,0,1] + ]; + return MMulti(R, M); +} + +function RotateY(M, Phi) { + var a = Phi; + a *= Math.PI / 180; + var Cos = Math.cos(a); + var Sin = Math.sin(a); + var R = [ + [Cos,0,Sin,0], + [0,1,0,0], + [-Sin,0,Cos,0], + [0,0,0,1] + ]; + return MMulti(R, M); +} + +function RotateZ(M, Phi) { + var a = Phi; + a *= Math.PI / 180; + var Cos = Math.cos(a); + var Sin = Math.sin(a); + var R = [ + [Cos,-Sin,0,0], + [Sin,Cos,0,0], + [0,0,1,0], + [0,0,0,1] + ]; + return MMulti(R, M); +} + +function DrawQube() { + // calc current normals + var CurN = new Array(); + var i = 5; + Q.LastPx = 0; + for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]); + if (CurN[0][2] < 0) { + if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; }; + if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; }; + if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; }; + if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; }; + } + if (CurN[1][2] < 0) { + if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; }; + if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; }; + if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; }; + if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; }; + } + if (CurN[2][2] < 0) { + if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; }; + if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; }; + if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; }; + if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; }; + } + if (CurN[3][2] < 0) { + if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; }; + if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; }; + if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; }; + if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; }; + } + if (CurN[4][2] < 0) { + if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; }; + if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; }; + if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; }; + if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; }; + } + if (CurN[5][2] < 0) { + if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; }; + if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; }; + if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; }; + if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; }; + } + Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false]; + Q.LastPx = 0; +} + +function Loop() { + if (Testing.LoopCount > Testing.LoopMax) return; + var TestingStr = String(Testing.LoopCount); + while (TestingStr.length < 3) TestingStr = "0" + TestingStr; + MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]); + MTrans = RotateX(MTrans, 1); + MTrans = RotateY(MTrans, 3); + MTrans = RotateZ(MTrans, 5); + MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]); + MQube = MMulti(MTrans, MQube); + var i = 8; + for (; i > -1; i--) { + Q[i].V = VMulti(MTrans, Q[i].V); + } + DrawQube(); + Testing.LoopCount++; + Loop(); +} + +function Init(CubeSize) { + // init/reset vars + Origin.V = [150,150,20,1]; + Testing.LoopCount = 0; + Testing.LoopMax = 50; + Testing.TimeMax = 0; + Testing.TimeAvg = 0; + Testing.TimeMin = 0; + Testing.TimeTemp = 0; + Testing.TimeTotal = 0; + Testing.Init = false; + + // transformation matrix + MTrans = [ + [1,0,0,0], + [0,1,0,0], + [0,0,1,0], + [0,0,0,1] + ]; + + // position information of qube + MQube = [ + [1,0,0,0], + [0,1,0,0], + [0,0,1,0], + [0,0,0,1] + ]; + + // entity matrix + I = [ + [1,0,0,0], + [0,1,0,0], + [0,0,1,0], + [0,0,0,1] + ]; + + // create qube + Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize); + Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize); + Q[2] = new CreateP( CubeSize, CubeSize, CubeSize); + Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize); + Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize); + Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize); + Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize); + Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize); + + // center of gravity + Q[8] = new CreateP(0, 0, 0); + + // anti-clockwise edge check + Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]]; + + // calculate squad normals + Q.Normal = new Array(); + for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V); + + // line drawn ? + Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false]; + + // create line pixels + Q.NumPx = 9 * 2 * CubeSize; + for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0); + + MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]); + MQube = MMulti(MTrans, MQube); + + var i = 0; + for (; i < 9; i++) { + Q[i].V = VMulti(MTrans, Q[i].V); + } + DrawQube(); + Testing.Init = true; + Loop(); +} + +for ( var i = 20; i <= 160; i *= 2 ) { + Init(i); +} + +Q = null; +MTrans = null; +MQube = null; +I = null; +Origin = null; +Testing = null; +LoopTime = null; +DisplArea = null; diff --git a/SunSpider/tests/3d-morph.js b/SunSpider/tests/3d-morph.js new file mode 100644 index 0000000..d4238c0 --- /dev/null +++ b/SunSpider/tests/3d-morph.js @@ -0,0 +1,54 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +var loops = 15 +var nx = 120 +var nz = 120 + +function morph(a, f) { + var PI2nx = Math.PI * 8/nx + var sin = Math.sin + var f30 = -(50 * sin(f*Math.PI*2)) + + for (var i = 0; i < nz; ++i) { + for (var j = 0; j < nx; ++j) { + a[3*(i*nx+j)+1] = sin((j-1) * PI2nx ) * -f30 + } + } +} + + +var a = Array() +for (var i=0; i < nx*nz*3; ++i) + a[i] = 0 + +for (var i = 0; i < loops; ++i) { + morph(a, i/loops) +} + +testOutput = 0; +for (var i = 0; i < nx; i++) + testOutput += a[3*(i*nx+i)+1]; +a = null; diff --git a/SunSpider/tests/3d-raytrace.js b/SunSpider/tests/3d-raytrace.js new file mode 100644 index 0000000..e7b959e --- /dev/null +++ b/SunSpider/tests/3d-raytrace.js @@ -0,0 +1,441 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +function createVector(x,y,z) { + return new Array(x,y,z); +} + +function sqrLengthVector(self) { + return self[0] * self[0] + self[1] * self[1] + self[2] * self[2]; +} + +function lengthVector(self) { + return Math.sqrt(self[0] * self[0] + self[1] * self[1] + self[2] * self[2]); +} + +function addVector(self, v) { + self[0] += v[0]; + self[1] += v[1]; + self[2] += v[2]; + return self; +} + +function subVector(self, v) { + self[0] -= v[0]; + self[1] -= v[1]; + self[2] -= v[2]; + return self; +} + +function scaleVector(self, scale) { + self[0] *= scale; + self[1] *= scale; + self[2] *= scale; + return self; +} + +function normaliseVector(self) { + var len = Math.sqrt(self[0] * self[0] + self[1] * self[1] + self[2] * self[2]); + self[0] /= len; + self[1] /= len; + self[2] /= len; + return self; +} + +function add(v1, v2) { + return new Array(v1[0] + v2[0], v1[1] + v2[1], v1[2] + v2[2]); +} + +function sub(v1, v2) { + return new Array(v1[0] - v2[0], v1[1] - v2[1], v1[2] - v2[2]); +} + +function scalev(v1, v2) { + return new Array(v1[0] * v2[0], v1[1] * v2[1], v1[2] * v2[2]); +} + +function dot(v1, v2) { + return v1[0] * v2[0] + v1[1] * v2[1] + v1[2] * v2[2]; +} + +function scale(v, scale) { + return [v[0] * scale, v[1] * scale, v[2] * scale]; +} + +function cross(v1, v2) { + return [v1[1] * v2[2] - v1[2] * v2[1], + v1[2] * v2[0] - v1[0] * v2[2], + v1[0] * v2[1] - v1[1] * v2[0]]; + +} + +function normalise(v) { + var len = lengthVector(v); + return [v[0] / len, v[1] / len, v[2] / len]; +} + +function transformMatrix(self, v) { + var vals = self; + var x = vals[0] * v[0] + vals[1] * v[1] + vals[2] * v[2] + vals[3]; + var y = vals[4] * v[0] + vals[5] * v[1] + vals[6] * v[2] + vals[7]; + var z = vals[8] * v[0] + vals[9] * v[1] + vals[10] * v[2] + vals[11]; + return [x, y, z]; +} + +function invertMatrix(self) { + var temp = new Array(16); + var tx = -self[3]; + var ty = -self[7]; + var tz = -self[11]; + for (h = 0; h < 3; h++) + for (v = 0; v < 3; v++) + temp[h + v * 4] = self[v + h * 4]; + for (i = 0; i < 11; i++) + self[i] = temp[i]; + self[3] = tx * self[0] + ty * self[1] + tz * self[2]; + self[7] = tx * self[4] + ty * self[5] + tz * self[6]; + self[11] = tx * self[8] + ty * self[9] + tz * self[10]; + return self; +} + + +// Triangle intersection using barycentric coord method +function Triangle(p1, p2, p3) { + var edge1 = sub(p3, p1); + var edge2 = sub(p2, p1); + var normal = cross(edge1, edge2); + if (Math.abs(normal[0]) > Math.abs(normal[1])) + if (Math.abs(normal[0]) > Math.abs(normal[2])) + this.axis = 0; + else + this.axis = 2; + else + if (Math.abs(normal[1]) > Math.abs(normal[2])) + this.axis = 1; + else + this.axis = 2; + var u = (this.axis + 1) % 3; + var v = (this.axis + 2) % 3; + var u1 = edge1[u]; + var v1 = edge1[v]; + + var u2 = edge2[u]; + var v2 = edge2[v]; + this.normal = normalise(normal); + this.nu = normal[u] / normal[this.axis]; + this.nv = normal[v] / normal[this.axis]; + this.nd = dot(normal, p1) / normal[this.axis]; + var det = u1 * v2 - v1 * u2; + this.eu = p1[u]; + this.ev = p1[v]; + this.nu1 = u1 / det; + this.nv1 = -v1 / det; + this.nu2 = v2 / det; + this.nv2 = -u2 / det; + this.material = [0.7, 0.7, 0.7]; +} + +Triangle.prototype.intersect = function(orig, dir, near, far) { + var u = (this.axis + 1) % 3; + var v = (this.axis + 2) % 3; + var d = dir[this.axis] + this.nu * dir[u] + this.nv * dir[v]; + var t = (this.nd - orig[this.axis] - this.nu * orig[u] - this.nv * orig[v]) / d; + if (t < near || t > far) + return null; + var Pu = orig[u] + t * dir[u] - this.eu; + var Pv = orig[v] + t * dir[v] - this.ev; + var a2 = Pv * this.nu1 + Pu * this.nv1; + if (a2 < 0) + return null; + var a3 = Pu * this.nu2 + Pv * this.nv2; + if (a3 < 0) + return null; + + if ((a2 + a3) > 1) + return null; + return t; +} + +function Scene(a_triangles) { + this.triangles = a_triangles; + this.lights = []; + this.ambient = [0,0,0]; + this.background = [0.8,0.8,1]; +} +var zero = new Array(0,0,0); + +Scene.prototype.intersect = function(origin, dir, near, far) { + var closest = null; + for (i = 0; i < this.triangles.length; i++) { + var triangle = this.triangles[i]; + var d = triangle.intersect(origin, dir, near, far); + if (d == null || d > far || d < near) + continue; + far = d; + closest = triangle; + } + + if (!closest) + return [this.background[0],this.background[1],this.background[2]]; + + var normal = closest.normal; + var hit = add(origin, scale(dir, far)); + if (dot(dir, normal) > 0) + normal = [-normal[0], -normal[1], -normal[2]]; + + var colour = null; + if (closest.shader) { + colour = closest.shader(closest, hit, dir); + } else { + colour = closest.material; + } + + // do reflection + var reflected = null; + if (colour.reflection > 0.001) { + var reflection = addVector(scale(normal, -2*dot(dir, normal)), dir); + reflected = this.intersect(hit, reflection, 0.0001, 1000000); + if (colour.reflection >= 0.999999) + return reflected; + } + + var l = [this.ambient[0], this.ambient[1], this.ambient[2]]; + for (var i = 0; i < this.lights.length; i++) { + var light = this.lights[i]; + var toLight = sub(light, hit); + var distance = lengthVector(toLight); + scaleVector(toLight, 1.0/distance); + distance -= 0.0001; + if (this.blocked(hit, toLight, distance)) + continue; + var nl = dot(normal, toLight); + if (nl > 0) + addVector(l, scale(light.colour, nl)); + } + l = scalev(l, colour); + if (reflected) { + l = addVector(scaleVector(l, 1 - colour.reflection), scaleVector(reflected, colour.reflection)); + } + return l; +} + +Scene.prototype.blocked = function(O, D, far) { + var near = 0.0001; + var closest = null; + for (i = 0; i < this.triangles.length; i++) { + var triangle = this.triangles[i]; + var d = triangle.intersect(O, D, near, far); + if (d == null || d > far || d < near) + continue; + return true; + } + + return false; +} + + +// this camera code is from notes i made ages ago, it is from *somewhere* -- i cannot remember where +// that somewhere is +function Camera(origin, lookat, up) { + var zaxis = normaliseVector(subVector(lookat, origin)); + var xaxis = normaliseVector(cross(up, zaxis)); + var yaxis = normaliseVector(cross(xaxis, subVector([0,0,0], zaxis))); + var m = new Array(16); + m[0] = xaxis[0]; m[1] = xaxis[1]; m[2] = xaxis[2]; + m[4] = yaxis[0]; m[5] = yaxis[1]; m[6] = yaxis[2]; + m[8] = zaxis[0]; m[9] = zaxis[1]; m[10] = zaxis[2]; + invertMatrix(m); + m[3] = 0; m[7] = 0; m[11] = 0; + this.origin = origin; + this.directions = new Array(4); + this.directions[0] = normalise([-0.7, 0.7, 1]); + this.directions[1] = normalise([ 0.7, 0.7, 1]); + this.directions[2] = normalise([ 0.7, -0.7, 1]); + this.directions[3] = normalise([-0.7, -0.7, 1]); + this.directions[0] = transformMatrix(m, this.directions[0]); + this.directions[1] = transformMatrix(m, this.directions[1]); + this.directions[2] = transformMatrix(m, this.directions[2]); + this.directions[3] = transformMatrix(m, this.directions[3]); +} + +Camera.prototype.generateRayPair = function(y) { + rays = new Array(new Object(), new Object()); + rays[0].origin = this.origin; + rays[1].origin = this.origin; + rays[0].dir = addVector(scale(this.directions[0], y), scale(this.directions[3], 1 - y)); + rays[1].dir = addVector(scale(this.directions[1], y), scale(this.directions[2], 1 - y)); + return rays; +} + +function renderRows(camera, scene, pixels, width, height, starty, stopy) { + for (var y = starty; y < stopy; y++) { + var rays = camera.generateRayPair(y / height); + for (var x = 0; x < width; x++) { + var xp = x / width; + var origin = addVector(scale(rays[0].origin, xp), scale(rays[1].origin, 1 - xp)); + var dir = normaliseVector(addVector(scale(rays[0].dir, xp), scale(rays[1].dir, 1 - xp))); + var l = scene.intersect(origin, dir); + pixels[y][x] = l; + } + } +} + +Camera.prototype.render = function(scene, pixels, width, height) { + var cam = this; + var row = 0; + renderRows(cam, scene, pixels, width, height, 0, height); +} + + + +function raytraceScene() +{ + var startDate = new Date().getTime(); + var numTriangles = 2 * 6; + var triangles = new Array();//numTriangles); + var tfl = createVector(-10, 10, -10); + var tfr = createVector( 10, 10, -10); + var tbl = createVector(-10, 10, 10); + var tbr = createVector( 10, 10, 10); + var bfl = createVector(-10, -10, -10); + var bfr = createVector( 10, -10, -10); + var bbl = createVector(-10, -10, 10); + var bbr = createVector( 10, -10, 10); + + // cube!!! + // front + var i = 0; + + triangles[i++] = new Triangle(tfl, tfr, bfr); + triangles[i++] = new Triangle(tfl, bfr, bfl); + // back + triangles[i++] = new Triangle(tbl, tbr, bbr); + triangles[i++] = new Triangle(tbl, bbr, bbl); + // triangles[i-1].material = [0.7,0.2,0.2]; + // triangles[i-1].material.reflection = 0.8; + // left + triangles[i++] = new Triangle(tbl, tfl, bbl); + // triangles[i-1].reflection = 0.6; + triangles[i++] = new Triangle(tfl, bfl, bbl); + // triangles[i-1].reflection = 0.6; + // right + triangles[i++] = new Triangle(tbr, tfr, bbr); + triangles[i++] = new Triangle(tfr, bfr, bbr); + // top + triangles[i++] = new Triangle(tbl, tbr, tfr); + triangles[i++] = new Triangle(tbl, tfr, tfl); + // bottom + triangles[i++] = new Triangle(bbl, bbr, bfr); + triangles[i++] = new Triangle(bbl, bfr, bfl); + + //Floor!!!! + var green = createVector(0.0, 0.4, 0.0); + var grey = createVector(0.4, 0.4, 0.4); + grey.reflection = 1.0; + var floorShader = function(tri, pos, view) { + var x = ((pos[0]/32) % 2 + 2) % 2; + var z = ((pos[2]/32 + 0.3) % 2 + 2) % 2; + if (x < 1 != z < 1) { + //in the real world we use the fresnel term... + // var angle = 1-dot(view, tri.normal); + // angle *= angle; + // angle *= angle; + // angle *= angle; + //grey.reflection = angle; + return grey; + } else + return green; + } + var ffl = createVector(-1000, -30, -1000); + var ffr = createVector( 1000, -30, -1000); + var fbl = createVector(-1000, -30, 1000); + var fbr = createVector( 1000, -30, 1000); + triangles[i++] = new Triangle(fbl, fbr, ffr); + triangles[i-1].shader = floorShader; + triangles[i++] = new Triangle(fbl, ffr, ffl); + triangles[i-1].shader = floorShader; + + var _scene = new Scene(triangles); + _scene.lights[0] = createVector(20, 38, -22); + _scene.lights[0].colour = createVector(0.7, 0.3, 0.3); + _scene.lights[1] = createVector(-23, 40, 17); + _scene.lights[1].colour = createVector(0.7, 0.3, 0.3); + _scene.lights[2] = createVector(23, 20, 17); + _scene.lights[2].colour = createVector(0.7, 0.7, 0.7); + _scene.ambient = createVector(0.1, 0.1, 0.1); + // _scene.background = createVector(0.7, 0.7, 1.0); + + var size = 30; + var pixels = new Array(); + for (var y = 0; y < size; y++) { + pixels[y] = new Array(); + for (var x = 0; x < size; x++) { + pixels[y][x] = 0; + } + } + + var _camera = new Camera(createVector(-40, 40, 40), createVector(0, 0, 0), createVector(0, 1, 0)); + _camera.render(_scene, pixels, size, size); + + return pixels; +} + +function arrayToCanvasCommands(pixels) +{ + var s = '\nvar pixels = ['; + var size = 30; + for (var y = 0; y < size; y++) { + s += "["; + for (var x = 0; x < size; x++) { + s += "[" + pixels[y][x] + "],"; + } + s+= "],"; + } + s += '];\n var canvas = document.getElementById("renderCanvas").getContext("2d");\n\ +\n\ +\n\ + var size = 30;\n\ + canvas.fillStyle = "red";\n\ + canvas.fillRect(0, 0, size, size);\n\ + canvas.scale(1, -1);\n\ + canvas.translate(0, -size);\n\ +\n\ + if (!canvas.setFillColor)\n\ + canvas.setFillColor = function(r, g, b, a) {\n\ + this.fillStyle = "rgb("+[Math.floor(r * 255), Math.floor(g * 255), Math.floor(b * 255)]+")";\n\ + }\n\ +\n\ +for (var y = 0; y < size; y++) {\n\ + for (var x = 0; x < size; x++) {\n\ + var l = pixels[y][x];\n\ + canvas.setFillColor(l[0], l[1], l[2], 1);\n\ + canvas.fillRect(x, y, 1, 1);\n\ + }\n\ +}'; + + return s; +} + +testOutput = arrayToCanvasCommands(raytraceScene()); diff --git a/SunSpider/tests/LIST b/SunSpider/tests/LIST new file mode 100644 index 0000000..34cfac4 --- /dev/null +++ b/SunSpider/tests/LIST @@ -0,0 +1,26 @@ +3d-cube +3d-morph +3d-raytrace +access-binary-trees +access-fannkuch +access-nbody +access-nsieve +bitops-3bit-bits-in-byte +bitops-bits-in-byte +bitops-bitwise-and +bitops-nsieve-bits +controlflow-recursive +crypto-aes +crypto-md5 +crypto-sha1 +date-format-tofte +date-format-xparb +math-cordic +math-partial-sums +math-spectral-norm +regexp-dna +string-base64 +string-fasta +string-tagcloud +string-unpack-code +string-validate-input diff --git a/SunSpider/tests/access-binary-trees.js b/SunSpider/tests/access-binary-trees.js new file mode 100644 index 0000000..2f24e7d --- /dev/null +++ b/SunSpider/tests/access-binary-trees.js @@ -0,0 +1,50 @@ +/* The Great Computer Language Shootout + http://shootout.alioth.debian.org/ + contributed by Isaac Gouy */ + +function TreeNode(left,right,item){ + this.left = left; + this.right = right; + this.item = item; +} + +TreeNode.prototype.itemCheck = function(){ + if (this.left==null) return this.item; + else return this.item + this.left.itemCheck() - this.right.itemCheck(); +} + +function bottomUpTree(item,depth){ + if (depth>0){ + return new TreeNode( + bottomUpTree(2*item-1, depth-1) + ,bottomUpTree(2*item, depth-1) + ,item + ); + } + else { + return new TreeNode(null,null,item); + } +} + +var ret; + +for ( var n = 4; n <= 7; n += 1 ) { + var minDepth = 4; + var maxDepth = Math.max(minDepth + 2, n); + var stretchDepth = maxDepth + 1; + + var check = bottomUpTree(0,stretchDepth).itemCheck(); + + var longLivedTree = bottomUpTree(0,maxDepth); + for (var depth=minDepth; depth<=maxDepth; depth+=2){ + var iterations = 1 << (maxDepth - depth + minDepth); + + check = 0; + for (var i=1; i<=iterations; i++){ + check += bottomUpTree(i,depth).itemCheck(); + check += bottomUpTree(-i,depth).itemCheck(); + } + } + + ret = longLivedTree.itemCheck(); +} diff --git a/SunSpider/tests/access-fannkuch.js b/SunSpider/tests/access-fannkuch.js new file mode 100644 index 0000000..1ea87b4 --- /dev/null +++ b/SunSpider/tests/access-fannkuch.js @@ -0,0 +1,66 @@ +/* The Great Computer Language Shootout + http://shootout.alioth.debian.org/ + contributed by Isaac Gouy */ + +function fannkuch(n) { + var check = 0; + var perm = Array(n); + var perm1 = Array(n); + var count = Array(n); + var maxPerm = Array(n); + var maxFlipsCount = 0; + var m = n - 1; + + for (var i = 0; i < n; i++) perm1[i] = i; + var r = n; + + while (true) { + // write-out the first 30 permutations + if (check < 30){ + var s = ""; + for(var i=0; i> 1; + for (var i = 0; i < k2; i++) { + var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp; + } + flipsCount++; + } + + if (flipsCount > maxFlipsCount) { + maxFlipsCount = flipsCount; + for (var i = 0; i < n; i++) maxPerm[i] = perm1[i]; + } + } + + while (true) { + if (r == n) return maxFlipsCount; + var perm0 = perm1[0]; + var i = 0; + while (i < r) { + var j = i + 1; + perm1[i] = perm1[j]; + i = j; + } + perm1[r] = perm0; + + count[r] = count[r] - 1; + if (count[r] > 0) break; + r++; + } + } +} + +var n = 8; +var ret = fannkuch(n); + diff --git a/SunSpider/tests/access-nbody.js b/SunSpider/tests/access-nbody.js new file mode 100644 index 0000000..f0d080d --- /dev/null +++ b/SunSpider/tests/access-nbody.js @@ -0,0 +1,169 @@ +/* The Great Computer Language Shootout + http://shootout.alioth.debian.org/ + contributed by Isaac Gouy */ + +var PI = 3.141592653589793; +var SOLAR_MASS = 4 * PI * PI; +var DAYS_PER_YEAR = 365.24; + +function Body(x,y,z,vx,vy,vz,mass){ + this.x = x; + this.y = y; + this.z = z; + this.vx = vx; + this.vy = vy; + this.vz = vz; + this.mass = mass; +} + +Body.prototype.offsetMomentum = function(px,py,pz) { + this.vx = -px / SOLAR_MASS; + this.vy = -py / SOLAR_MASS; + this.vz = -pz / SOLAR_MASS; + return this; +} + +function Jupiter(){ + return new Body( + 4.84143144246472090e+00, + -1.16032004402742839e+00, + -1.03622044471123109e-01, + 1.66007664274403694e-03 * DAYS_PER_YEAR, + 7.69901118419740425e-03 * DAYS_PER_YEAR, + -6.90460016972063023e-05 * DAYS_PER_YEAR, + 9.54791938424326609e-04 * SOLAR_MASS + ); +} + +function Saturn(){ + return new Body( + 8.34336671824457987e+00, + 4.12479856412430479e+00, + -4.03523417114321381e-01, + -2.76742510726862411e-03 * DAYS_PER_YEAR, + 4.99852801234917238e-03 * DAYS_PER_YEAR, + 2.30417297573763929e-05 * DAYS_PER_YEAR, + 2.85885980666130812e-04 * SOLAR_MASS + ); +} + +function Uranus(){ + return new Body( + 1.28943695621391310e+01, + -1.51111514016986312e+01, + -2.23307578892655734e-01, + 2.96460137564761618e-03 * DAYS_PER_YEAR, + 2.37847173959480950e-03 * DAYS_PER_YEAR, + -2.96589568540237556e-05 * DAYS_PER_YEAR, + 4.36624404335156298e-05 * SOLAR_MASS + ); +} + +function Neptune(){ + return new Body( + 1.53796971148509165e+01, + -2.59193146099879641e+01, + 1.79258772950371181e-01, + 2.68067772490389322e-03 * DAYS_PER_YEAR, + 1.62824170038242295e-03 * DAYS_PER_YEAR, + -9.51592254519715870e-05 * DAYS_PER_YEAR, + 5.15138902046611451e-05 * SOLAR_MASS + ); +} + +function Sun(){ + return new Body(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, SOLAR_MASS); +} + + +function NBodySystem(bodies){ + this.bodies = bodies; + var px = 0.0; + var py = 0.0; + var pz = 0.0; + var size = this.bodies.length; + for (var i=0; i0){ + for (var i=1; i<=prefixWidth; i++) s = " " + s; + } + return s; +} + +function nsieve(m, isPrime){ + var i, k, count; + + for (i=2; i<=m; i++) { isPrime[i] = true; } + count = 0; + + for (i=2; i<=m; i++){ + if (isPrime[i]) { + for (k=i+i; k<=m; k+=i) isPrime[k] = false; + count++; + } + } + return count; +} + +function sieve() { + for (var i = 1; i <= 3; i++ ) { + var m = (1<> ((b << 1) & 14)); +c += 3 & (bi3b >> ((b >> 2) & 14)); +c += 3 & (bi3b >> ((b >> 5) & 6)); +return c; + +/* +lir4,0xE994; 9 instructions, no memory access, minimal register dependence, 6 shifts, 2 adds, 1 inline assign +rlwinmr5,r3,1,28,30 +rlwinmr6,r3,30,28,30 +rlwinmr7,r3,27,29,30 +rlwnmr8,r4,r5,30,31 +rlwnmr9,r4,r6,30,31 +rlwnmr10,r4,r7,30,31 +addr3,r8,r9 +addr3,r3,r10 +*/ +} + + +function TimeFunc(func) { +var x, y, t; +for(var x=0; x<500; x++) +for(var y=0; y<256; y++) func(y); +} + +TimeFunc(fast3bitlookup); diff --git a/SunSpider/tests/bitops-bits-in-byte.js b/SunSpider/tests/bitops-bits-in-byte.js new file mode 100644 index 0000000..9a3acd4 --- /dev/null +++ b/SunSpider/tests/bitops-bits-in-byte.js @@ -0,0 +1,21 @@ +// Copyright (c) 2004 by Arthur Langereis (arthur_ext at domain xfinitegames, tld com) + + +// 1 op = 2 assigns, 16 compare/branches, 8 ANDs, (0-8) ADDs, 8 SHLs +// O(n) +function bitsinbyte(b) { +var m = 1, c = 0; +while(m<0x100) { +if(b & m) c++; +m <<= 1; +} +return c; +} + +function TimeFunc(func) { +var x, y, t; +for(var x=0; x<350; x++) +for(var y=0; y<256; y++) func(y); +} + +TimeFunc(bitsinbyte); diff --git a/SunSpider/tests/bitops-bitwise-and.js b/SunSpider/tests/bitops-bitwise-and.js new file mode 100644 index 0000000..7c80e69 --- /dev/null +++ b/SunSpider/tests/bitops-bitwise-and.js @@ -0,0 +1,28 @@ +/* + * Copyright (C) 2007 Apple Inc. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +bitwiseAndValue = 4294967296; +for (var i = 0; i < 600000; i++) + bitwiseAndValue = bitwiseAndValue & i; diff --git a/SunSpider/tests/bitops-nsieve-bits.js b/SunSpider/tests/bitops-nsieve-bits.js new file mode 100644 index 0000000..6ef0ddb --- /dev/null +++ b/SunSpider/tests/bitops-nsieve-bits.js @@ -0,0 +1,32 @@ +// The Great Computer Language Shootout +// http://shootout.alioth.debian.org +// +// Contributed by Ian Osgood + +function pad(n,width) { + var s = n.toString(); + while (s.length < width) s = ' ' + s; + return s; +} + +function primes(isPrime, n) { + var i, count = 0, m = 10000<>5; + + for (i=0; i>5] & 1<<(i&31)) { + for (var j=i+i; j>5] &= ~(1<<(j&31)); + count++; + } +} + +function sieve() { + for (var i = 4; i <= 4; i++) { + var isPrime = new Array((10000<>5); + primes(isPrime, i); + } +} + +sieve(); diff --git a/SunSpider/tests/controlflow-recursive.js b/SunSpider/tests/controlflow-recursive.js new file mode 100644 index 0000000..fcfe1c4 --- /dev/null +++ b/SunSpider/tests/controlflow-recursive.js @@ -0,0 +1,25 @@ +// The Computer Language Shootout +// http://shootout.alioth.debian.org/ +// contributed by Isaac Gouy + +function ack(m,n){ + if (m==0) { return n+1; } + if (n==0) { return ack(m-1,1); } + return ack(m-1, ack(m,n-1) ); +} + +function fib(n) { + if (n < 2){ return 1; } + return fib(n-2) + fib(n-1); +} + +function tak(x,y,z) { + if (y >= x) return z; + return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y)); +} + +for ( var i = 3; i <= 5; i++ ) { + ack(3,i); + fib(17.0+i); + tak(3*i+3,2*i+2,i+1); +} diff --git a/SunSpider/tests/crypto-aes.js b/SunSpider/tests/crypto-aes.js new file mode 100644 index 0000000..93a5969 --- /dev/null +++ b/SunSpider/tests/crypto-aes.js @@ -0,0 +1,422 @@ +/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */ + +/* + * AES Cipher function: encrypt 'input' with Rijndael algorithm + * + * takes byte-array 'input' (16 bytes) + * 2D byte-array key schedule 'w' (Nr+1 x Nb bytes) + * + * applies Nr rounds (10/12/14) using key schedule w for 'add round key' stage + * + * returns byte-array encrypted value (16 bytes) + */ +function Cipher(input, w) { // main Cipher function [§5.1] + var Nb = 4; // block size (in words): no of columns in state (fixed at 4 for AES) + var Nr = w.length/Nb - 1; // no of rounds: 10/12/14 for 128/192/256-bit keys + + var state = [[],[],[],[]]; // initialise 4xNb byte-array 'state' with input [§3.4] + for (var i=0; i<4*Nb; i++) state[i%4][Math.floor(i/4)] = input[i]; + + state = AddRoundKey(state, w, 0, Nb); + + for (var round=1; round 6 && i%Nk == 4) { + temp = SubWord(temp); + } + for (var t=0; t<4; t++) w[i][t] = w[i-Nk][t] ^ temp[t]; + } + + return w; +} + +function SubWord(w) { // apply SBox to 4-byte word w + for (var i=0; i<4; i++) w[i] = Sbox[w[i]]; + return w; +} + +function RotWord(w) { // rotate 4-byte word w left by one byte + w[4] = w[0]; + for (var i=0; i<4; i++) w[i] = w[i+1]; + return w; +} + + +// Sbox is pre-computed multiplicative inverse in GF(2^8) used in SubBytes and KeyExpansion [§5.1.1] +var Sbox = [0x63,0x7c,0x77,0x7b,0xf2,0x6b,0x6f,0xc5,0x30,0x01,0x67,0x2b,0xfe,0xd7,0xab,0x76, + 0xca,0x82,0xc9,0x7d,0xfa,0x59,0x47,0xf0,0xad,0xd4,0xa2,0xaf,0x9c,0xa4,0x72,0xc0, + 0xb7,0xfd,0x93,0x26,0x36,0x3f,0xf7,0xcc,0x34,0xa5,0xe5,0xf1,0x71,0xd8,0x31,0x15, + 0x04,0xc7,0x23,0xc3,0x18,0x96,0x05,0x9a,0x07,0x12,0x80,0xe2,0xeb,0x27,0xb2,0x75, + 0x09,0x83,0x2c,0x1a,0x1b,0x6e,0x5a,0xa0,0x52,0x3b,0xd6,0xb3,0x29,0xe3,0x2f,0x84, + 0x53,0xd1,0x00,0xed,0x20,0xfc,0xb1,0x5b,0x6a,0xcb,0xbe,0x39,0x4a,0x4c,0x58,0xcf, + 0xd0,0xef,0xaa,0xfb,0x43,0x4d,0x33,0x85,0x45,0xf9,0x02,0x7f,0x50,0x3c,0x9f,0xa8, + 0x51,0xa3,0x40,0x8f,0x92,0x9d,0x38,0xf5,0xbc,0xb6,0xda,0x21,0x10,0xff,0xf3,0xd2, + 0xcd,0x0c,0x13,0xec,0x5f,0x97,0x44,0x17,0xc4,0xa7,0x7e,0x3d,0x64,0x5d,0x19,0x73, + 0x60,0x81,0x4f,0xdc,0x22,0x2a,0x90,0x88,0x46,0xee,0xb8,0x14,0xde,0x5e,0x0b,0xdb, + 0xe0,0x32,0x3a,0x0a,0x49,0x06,0x24,0x5c,0xc2,0xd3,0xac,0x62,0x91,0x95,0xe4,0x79, + 0xe7,0xc8,0x37,0x6d,0x8d,0xd5,0x4e,0xa9,0x6c,0x56,0xf4,0xea,0x65,0x7a,0xae,0x08, + 0xba,0x78,0x25,0x2e,0x1c,0xa6,0xb4,0xc6,0xe8,0xdd,0x74,0x1f,0x4b,0xbd,0x8b,0x8a, + 0x70,0x3e,0xb5,0x66,0x48,0x03,0xf6,0x0e,0x61,0x35,0x57,0xb9,0x86,0xc1,0x1d,0x9e, + 0xe1,0xf8,0x98,0x11,0x69,0xd9,0x8e,0x94,0x9b,0x1e,0x87,0xe9,0xce,0x55,0x28,0xdf, + 0x8c,0xa1,0x89,0x0d,0xbf,0xe6,0x42,0x68,0x41,0x99,0x2d,0x0f,0xb0,0x54,0xbb,0x16]; + +// Rcon is Round Constant used for the Key Expansion [1st col is 2^(r-1) in GF(2^8)] [§5.2] +var Rcon = [ [0x00, 0x00, 0x00, 0x00], + [0x01, 0x00, 0x00, 0x00], + [0x02, 0x00, 0x00, 0x00], + [0x04, 0x00, 0x00, 0x00], + [0x08, 0x00, 0x00, 0x00], + [0x10, 0x00, 0x00, 0x00], + [0x20, 0x00, 0x00, 0x00], + [0x40, 0x00, 0x00, 0x00], + [0x80, 0x00, 0x00, 0x00], + [0x1b, 0x00, 0x00, 0x00], + [0x36, 0x00, 0x00, 0x00] ]; + + +/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */ + +/* + * Use AES to encrypt 'plaintext' with 'password' using 'nBits' key, in 'Counter' mode of operation + * - see http://csrc.nist.gov/publications/nistpubs/800-38a/sp800-38a.pdf + * for each block + * - outputblock = cipher(counter, key) + * - cipherblock = plaintext xor outputblock + */ +function AESEncryptCtr(plaintext, password, nBits) { + if (!(nBits==128 || nBits==192 || nBits==256)) return ''; // standard allows 128/192/256 bit keys + + // for this example script, generate the key by applying Cipher to 1st 16/24/32 chars of password; + // for real-world applications, a more secure approach would be to hash the password e.g. with SHA-1 + var nBytes = nBits/8; // no bytes in key + var pwBytes = new Array(nBytes); + for (var i=0; i>> i*8) & 0xff; + for (var i=0; i<4; i++) counterBlock[i+4] = (nonce/0x100000000 >>> i*8) & 0xff; + + // generate key schedule - an expansion of the key into distinct Key Rounds for each round + var keySchedule = KeyExpansion(key); + + var blockCount = Math.ceil(plaintext.length/blockSize); + var ciphertext = new Array(blockCount); // ciphertext as array of strings + + for (var b=0; b>> c*8) & 0xff; + for (var c=0; c<4; c++) counterBlock[15-c-4] = (b/0x100000000 >>> c*8) + + var cipherCntr = Cipher(counterBlock, keySchedule); // -- encrypt counter block -- + + // calculate length of final block: + var blockLength = b>> c*8) & 0xff; + for (var c=0; c<4; c++) counterBlock[15-c-4] = ((b/0x100000000-1) >>> c*8) & 0xff; + + var cipherCntr = Cipher(counterBlock, keySchedule); // encrypt counter block + + ciphertext[b] = unescCtrlChars(ciphertext[b]); + + var pt = ''; + for (var i=0; i>18 & 0x3f; + h2 = bits>>12 & 0x3f; + h3 = bits>>6 & 0x3f; + h4 = bits & 0x3f; + + // end of string? index to '=' in b64 + if (isNaN(o3)) h4 = 64; + if (isNaN(o2)) h3 = 64; + + // use hexets to index into b64, and append result to encoded string + enc += b64.charAt(h1) + b64.charAt(h2) + b64.charAt(h3) + b64.charAt(h4); + } while (i < str.length); + + return enc; +} + +function decodeBase64(str) { + var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc=''; + + do { // unpack four hexets into three octets using index points in b64 + h1 = b64.indexOf(str.charAt(i++)); + h2 = b64.indexOf(str.charAt(i++)); + h3 = b64.indexOf(str.charAt(i++)); + h4 = b64.indexOf(str.charAt(i++)); + + bits = h1<<18 | h2<<12 | h3<<6 | h4; + + o1 = bits>>16 & 0xff; + o2 = bits>>8 & 0xff; + o3 = bits & 0xff; + + if (h3 == 64) enc += String.fromCharCode(o1); + else if (h4 == 64) enc += String.fromCharCode(o1, o2); + else enc += String.fromCharCode(o1, o2, o3); + } while (i < str.length); + + return decodeUTF8(enc); // decode UTF-8 byte-array back to Unicode +} + +function encodeUTF8(str) { // encode multi-byte string into utf-8 multiple single-byte characters + str = str.replace( + /[\u0080-\u07ff]/g, // U+0080 - U+07FF = 2-byte chars + function(c) { + var cc = c.charCodeAt(0); + return String.fromCharCode(0xc0 | cc>>6, 0x80 | cc&0x3f); } + ); + str = str.replace( + /[\u0800-\uffff]/g, // U+0800 - U+FFFF = 3-byte chars + function(c) { + var cc = c.charCodeAt(0); + return String.fromCharCode(0xe0 | cc>>12, 0x80 | cc>>6&0x3F, 0x80 | cc&0x3f); } + ); + return str; +} + +function decodeUTF8(str) { // decode utf-8 encoded string back into multi-byte characters + str = str.replace( + /[\u00c0-\u00df][\u0080-\u00bf]/g, // 2-byte chars + function(c) { + var cc = (c.charCodeAt(0)&0x1f)<<6 | c.charCodeAt(1)&0x3f; + return String.fromCharCode(cc); } + ); + str = str.replace( + /[\u00e0-\u00ef][\u0080-\u00bf][\u0080-\u00bf]/g, // 3-byte chars + function(c) { + var cc = (c.charCodeAt(0)&0x0f)<<12 | (c.charCodeAt(1)&0x3f<<6) | c.charCodeAt(2)&0x3f; + return String.fromCharCode(cc); } + ); + return str; +} + + +function byteArrayToHexStr(b) { // convert byte array to hex string for displaying test vectors + var s = ''; + for (var i=0; i> 5] |= 0x80 << ((len) % 32); + x[(((len + 64) >>> 9) << 4) + 14] = len; + + var a = 1732584193; + var b = -271733879; + var c = -1732584194; + var d = 271733878; + + for(var i = 0; i < x.length; i += 16) + { + var olda = a; + var oldb = b; + var oldc = c; + var oldd = d; + + a = md5_ff(a, b, c, d, x[i+ 0], 7 , -680876936); + d = md5_ff(d, a, b, c, x[i+ 1], 12, -389564586); + c = md5_ff(c, d, a, b, x[i+ 2], 17, 606105819); + b = md5_ff(b, c, d, a, x[i+ 3], 22, -1044525330); + a = md5_ff(a, b, c, d, x[i+ 4], 7 , -176418897); + d = md5_ff(d, a, b, c, x[i+ 5], 12, 1200080426); + c = md5_ff(c, d, a, b, x[i+ 6], 17, -1473231341); + b = md5_ff(b, c, d, a, x[i+ 7], 22, -45705983); + a = md5_ff(a, b, c, d, x[i+ 8], 7 , 1770035416); + d = md5_ff(d, a, b, c, x[i+ 9], 12, -1958414417); + c = md5_ff(c, d, a, b, x[i+10], 17, -42063); + b = md5_ff(b, c, d, a, x[i+11], 22, -1990404162); + a = md5_ff(a, b, c, d, x[i+12], 7 , 1804603682); + d = md5_ff(d, a, b, c, x[i+13], 12, -40341101); + c = md5_ff(c, d, a, b, x[i+14], 17, -1502002290); + b = md5_ff(b, c, d, a, x[i+15], 22, 1236535329); + + a = md5_gg(a, b, c, d, x[i+ 1], 5 , -165796510); + d = md5_gg(d, a, b, c, x[i+ 6], 9 , -1069501632); + c = md5_gg(c, d, a, b, x[i+11], 14, 643717713); + b = md5_gg(b, c, d, a, x[i+ 0], 20, -373897302); + a = md5_gg(a, b, c, d, x[i+ 5], 5 , -701558691); + d = md5_gg(d, a, b, c, x[i+10], 9 , 38016083); + c = md5_gg(c, d, a, b, x[i+15], 14, -660478335); + b = md5_gg(b, c, d, a, x[i+ 4], 20, -405537848); + a = md5_gg(a, b, c, d, x[i+ 9], 5 , 568446438); + d = md5_gg(d, a, b, c, x[i+14], 9 , -1019803690); + c = md5_gg(c, d, a, b, x[i+ 3], 14, -187363961); + b = md5_gg(b, c, d, a, x[i+ 8], 20, 1163531501); + a = md5_gg(a, b, c, d, x[i+13], 5 , -1444681467); + d = md5_gg(d, a, b, c, x[i+ 2], 9 , -51403784); + c = md5_gg(c, d, a, b, x[i+ 7], 14, 1735328473); + b = md5_gg(b, c, d, a, x[i+12], 20, -1926607734); + + a = md5_hh(a, b, c, d, x[i+ 5], 4 , -378558); + d = md5_hh(d, a, b, c, x[i+ 8], 11, -2022574463); + c = md5_hh(c, d, a, b, x[i+11], 16, 1839030562); + b = md5_hh(b, c, d, a, x[i+14], 23, -35309556); + a = md5_hh(a, b, c, d, x[i+ 1], 4 , -1530992060); + d = md5_hh(d, a, b, c, x[i+ 4], 11, 1272893353); + c = md5_hh(c, d, a, b, x[i+ 7], 16, -155497632); + b = md5_hh(b, c, d, a, x[i+10], 23, -1094730640); + a = md5_hh(a, b, c, d, x[i+13], 4 , 681279174); + d = md5_hh(d, a, b, c, x[i+ 0], 11, -358537222); + c = md5_hh(c, d, a, b, x[i+ 3], 16, -722521979); + b = md5_hh(b, c, d, a, x[i+ 6], 23, 76029189); + a = md5_hh(a, b, c, d, x[i+ 9], 4 , -640364487); + d = md5_hh(d, a, b, c, x[i+12], 11, -421815835); + c = md5_hh(c, d, a, b, x[i+15], 16, 530742520); + b = md5_hh(b, c, d, a, x[i+ 2], 23, -995338651); + + a = md5_ii(a, b, c, d, x[i+ 0], 6 , -198630844); + d = md5_ii(d, a, b, c, x[i+ 7], 10, 1126891415); + c = md5_ii(c, d, a, b, x[i+14], 15, -1416354905); + b = md5_ii(b, c, d, a, x[i+ 5], 21, -57434055); + a = md5_ii(a, b, c, d, x[i+12], 6 , 1700485571); + d = md5_ii(d, a, b, c, x[i+ 3], 10, -1894986606); + c = md5_ii(c, d, a, b, x[i+10], 15, -1051523); + b = md5_ii(b, c, d, a, x[i+ 1], 21, -2054922799); + a = md5_ii(a, b, c, d, x[i+ 8], 6 , 1873313359); + d = md5_ii(d, a, b, c, x[i+15], 10, -30611744); + c = md5_ii(c, d, a, b, x[i+ 6], 15, -1560198380); + b = md5_ii(b, c, d, a, x[i+13], 21, 1309151649); + a = md5_ii(a, b, c, d, x[i+ 4], 6 , -145523070); + d = md5_ii(d, a, b, c, x[i+11], 10, -1120210379); + c = md5_ii(c, d, a, b, x[i+ 2], 15, 718787259); + b = md5_ii(b, c, d, a, x[i+ 9], 21, -343485551); + + a = safe_add(a, olda); + b = safe_add(b, oldb); + c = safe_add(c, oldc); + d = safe_add(d, oldd); + } + return Array(a, b, c, d); + +} + +/* + * These functions implement the four basic operations the algorithm uses. + */ +function md5_cmn(q, a, b, x, s, t) +{ + return safe_add(bit_rol(safe_add(safe_add(a, q), safe_add(x, t)), s),b); +} +function md5_ff(a, b, c, d, x, s, t) +{ + return md5_cmn((b & c) | ((~b) & d), a, b, x, s, t); +} +function md5_gg(a, b, c, d, x, s, t) +{ + return md5_cmn((b & d) | (c & (~d)), a, b, x, s, t); +} +function md5_hh(a, b, c, d, x, s, t) +{ + return md5_cmn(b ^ c ^ d, a, b, x, s, t); +} +function md5_ii(a, b, c, d, x, s, t) +{ + return md5_cmn(c ^ (b | (~d)), a, b, x, s, t); +} + +/* + * Calculate the HMAC-MD5, of a key and some data + */ +function core_hmac_md5(key, data) +{ + var bkey = str2binl(key); + if(bkey.length > 16) bkey = core_md5(bkey, key.length * chrsz); + + var ipad = Array(16), opad = Array(16); + for(var i = 0; i < 16; i++) + { + ipad[i] = bkey[i] ^ 0x36363636; + opad[i] = bkey[i] ^ 0x5C5C5C5C; + } + + var hash = core_md5(ipad.concat(str2binl(data)), 512 + data.length * chrsz); + return core_md5(opad.concat(hash), 512 + 128); +} + +/* + * Add integers, wrapping at 2^32. This uses 16-bit operations internally + * to work around bugs in some JS interpreters. + */ +function safe_add(x, y) +{ + var lsw = (x & 0xFFFF) + (y & 0xFFFF); + var msw = (x >> 16) + (y >> 16) + (lsw >> 16); + return (msw << 16) | (lsw & 0xFFFF); +} + +/* + * Bitwise rotate a 32-bit number to the left. + */ +function bit_rol(num, cnt) +{ + return (num << cnt) | (num >>> (32 - cnt)); +} + +/* + * Convert a string to an array of little-endian words + * If chrsz is ASCII, characters >255 have their hi-byte silently ignored. + */ +function str2binl(str) +{ + var bin = Array(); + var mask = (1 << chrsz) - 1; + for(var i = 0; i < str.length * chrsz; i += chrsz) + bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (i%32); + return bin; +} + +/* + * Convert an array of little-endian words to a string + */ +function binl2str(bin) +{ + var str = ""; + var mask = (1 << chrsz) - 1; + for(var i = 0; i < bin.length * 32; i += chrsz) + str += String.fromCharCode((bin[i>>5] >>> (i % 32)) & mask); + return str; +} + +/* + * Convert an array of little-endian words to a hex string. + */ +function binl2hex(binarray) +{ + var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef"; + var str = ""; + for(var i = 0; i < binarray.length * 4; i++) + { + str += hex_tab.charAt((binarray[i>>2] >> ((i%4)*8+4)) & 0xF) + + hex_tab.charAt((binarray[i>>2] >> ((i%4)*8 )) & 0xF); + } + return str; +} + +/* + * Convert an array of little-endian words to a base-64 string + */ +function binl2b64(binarray) +{ + var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/"; + var str = ""; + for(var i = 0; i < binarray.length * 4; i += 3) + { + var triplet = (((binarray[i >> 2] >> 8 * ( i %4)) & 0xFF) << 16) + | (((binarray[i+1 >> 2] >> 8 * ((i+1)%4)) & 0xFF) << 8 ) + | ((binarray[i+2 >> 2] >> 8 * ((i+2)%4)) & 0xFF); + for(var j = 0; j < 4; j++) + { + if(i * 8 + j * 6 > binarray.length * 32) str += b64pad; + else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F); + } + } + return str; +} + +var plainText = "Rebellious subjects, enemies to peace,\n\ +Profaners of this neighbour-stained steel,--\n\ +Will they not hear? What, ho! you men, you beasts,\n\ +That quench the fire of your pernicious rage\n\ +With purple fountains issuing from your veins,\n\ +On pain of torture, from those bloody hands\n\ +Throw your mistemper'd weapons to the ground,\n\ +And hear the sentence of your moved prince.\n\ +Three civil brawls, bred of an airy word,\n\ +By thee, old Capulet, and Montague,\n\ +Have thrice disturb'd the quiet of our streets,\n\ +And made Verona's ancient citizens\n\ +Cast by their grave beseeming ornaments,\n\ +To wield old partisans, in hands as old,\n\ +Canker'd with peace, to part your canker'd hate:\n\ +If ever you disturb our streets again,\n\ +Your lives shall pay the forfeit of the peace.\n\ +For this time, all the rest depart away:\n\ +You Capulet; shall go along with me:\n\ +And, Montague, come you this afternoon,\n\ +To know our further pleasure in this case,\n\ +To old Free-town, our common judgment-place.\n\ +Once more, on pain of death, all men depart." + +for (var i = 0; i <4; i++) { + plainText += plainText; +} + +var md5Output = hex_md5(plainText); diff --git a/SunSpider/tests/crypto-sha1.js b/SunSpider/tests/crypto-sha1.js new file mode 100644 index 0000000..ca8d901 --- /dev/null +++ b/SunSpider/tests/crypto-sha1.js @@ -0,0 +1,224 @@ +/* + * A JavaScript implementation of the Secure Hash Algorithm, SHA-1, as defined + * in FIPS PUB 180-1 + * Version 2.1a Copyright Paul Johnston 2000 - 2002. + * Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet + * Distributed under the BSD License + * See http://pajhome.org.uk/crypt/md5 for details. + */ + +/* + * Configurable variables. You may need to tweak these to be compatible with + * the server-side, but the defaults work in most cases. + */ +var hexcase = 0; /* hex output format. 0 - lowercase; 1 - uppercase */ +var b64pad = ""; /* base-64 pad character. "=" for strict RFC compliance */ +var chrsz = 8; /* bits per input character. 8 - ASCII; 16 - Unicode */ + +/* + * These are the functions you'll usually want to call + * They take string arguments and return either hex or base-64 encoded strings + */ +function hex_sha1(s){return binb2hex(core_sha1(str2binb(s),s.length * chrsz));} +function b64_sha1(s){return binb2b64(core_sha1(str2binb(s),s.length * chrsz));} +function str_sha1(s){return binb2str(core_sha1(str2binb(s),s.length * chrsz));} +function hex_hmac_sha1(key, data){ return binb2hex(core_hmac_sha1(key, data));} +function b64_hmac_sha1(key, data){ return binb2b64(core_hmac_sha1(key, data));} +function str_hmac_sha1(key, data){ return binb2str(core_hmac_sha1(key, data));} + +/* + * Perform a simple self-test to see if the VM is working + */ +function sha1_vm_test() +{ + return hex_sha1("abc") == "a9993e364706816aba3e25717850c26c9cd0d89d"; +} + +/* + * Calculate the SHA-1 of an array of big-endian words, and a bit length + */ +function core_sha1(x, len) +{ + /* append padding */ + x[len >> 5] |= 0x80 << (24 - len % 32); + x[((len + 64 >> 9) << 4) + 15] = len; + + var w = Array(80); + var a = 1732584193; + var b = -271733879; + var c = -1732584194; + var d = 271733878; + var e = -1009589776; + + for(var i = 0; i < x.length; i += 16) + { + var olda = a; + var oldb = b; + var oldc = c; + var oldd = d; + var olde = e; + + for(var j = 0; j < 80; j++) + { + if(j < 16) w[j] = x[i + j]; + else w[j] = rol(w[j-3] ^ w[j-8] ^ w[j-14] ^ w[j-16], 1); + var t = safe_add(safe_add(rol(a, 5), sha1_ft(j, b, c, d)), + safe_add(safe_add(e, w[j]), sha1_kt(j))); + e = d; + d = c; + c = rol(b, 30); + b = a; + a = t; + } + + a = safe_add(a, olda); + b = safe_add(b, oldb); + c = safe_add(c, oldc); + d = safe_add(d, oldd); + e = safe_add(e, olde); + } + return Array(a, b, c, d, e); + +} + +/* + * Perform the appropriate triplet combination function for the current + * iteration + */ +function sha1_ft(t, b, c, d) +{ + if(t < 20) return (b & c) | ((~b) & d); + if(t < 40) return b ^ c ^ d; + if(t < 60) return (b & c) | (b & d) | (c & d); + return b ^ c ^ d; +} + +/* + * Determine the appropriate additive constant for the current iteration + */ +function sha1_kt(t) +{ + return (t < 20) ? 1518500249 : (t < 40) ? 1859775393 : + (t < 60) ? -1894007588 : -899497514; +} + +/* + * Calculate the HMAC-SHA1 of a key and some data + */ +function core_hmac_sha1(key, data) +{ + var bkey = str2binb(key); + if(bkey.length > 16) bkey = core_sha1(bkey, key.length * chrsz); + + var ipad = Array(16), opad = Array(16); + for(var i = 0; i < 16; i++) + { + ipad[i] = bkey[i] ^ 0x36363636; + opad[i] = bkey[i] ^ 0x5C5C5C5C; + } + + var hash = core_sha1(ipad.concat(str2binb(data)), 512 + data.length * chrsz); + return core_sha1(opad.concat(hash), 512 + 160); +} + +/* + * Add integers, wrapping at 2^32. This uses 16-bit operations internally + * to work around bugs in some JS interpreters. + */ +function safe_add(x, y) +{ + var lsw = (x & 0xFFFF) + (y & 0xFFFF); + var msw = (x >> 16) + (y >> 16) + (lsw >> 16); + return (msw << 16) | (lsw & 0xFFFF); +} + +/* + * Bitwise rotate a 32-bit number to the left. + */ +function rol(num, cnt) +{ + return (num << cnt) | (num >>> (32 - cnt)); +} + +/* + * Convert an 8-bit or 16-bit string to an array of big-endian words + * In 8-bit function, characters >255 have their hi-byte silently ignored. + */ +function str2binb(str) +{ + var bin = Array(); + var mask = (1 << chrsz) - 1; + for(var i = 0; i < str.length * chrsz; i += chrsz) + bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (32 - chrsz - i%32); + return bin; +} + +/* + * Convert an array of big-endian words to a string + */ +function binb2str(bin) +{ + var str = ""; + var mask = (1 << chrsz) - 1; + for(var i = 0; i < bin.length * 32; i += chrsz) + str += String.fromCharCode((bin[i>>5] >>> (32 - chrsz - i%32)) & mask); + return str; +} + +/* + * Convert an array of big-endian words to a hex string. + */ +function binb2hex(binarray) +{ + var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef"; + var str = ""; + for(var i = 0; i < binarray.length * 4; i++) + { + str += hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8+4)) & 0xF) + + hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8 )) & 0xF); + } + return str; +} + +/* + * Convert an array of big-endian words to a base-64 string + */ +function binb2b64(binarray) +{ + var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/"; + var str = ""; + for(var i = 0; i < binarray.length * 4; i += 3) + { + var triplet = (((binarray[i >> 2] >> 8 * (3 - i %4)) & 0xFF) << 16) + | (((binarray[i+1 >> 2] >> 8 * (3 - (i+1)%4)) & 0xFF) << 8 ) + | ((binarray[i+2 >> 2] >> 8 * (3 - (i+2)%4)) & 0xFF); + for(var j = 0; j < 4; j++) + { + if(i * 8 + j * 6 > binarray.length * 32) str += b64pad; + else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F); + } + } + return str; +} + + +var plainText = "Two households, both alike in dignity,\n\ +In fair Verona, where we lay our scene,\n\ +From ancient grudge break to new mutiny,\n\ +Where civil blood makes civil hands unclean.\n\ +From forth the fatal loins of these two foes\n\ +A pair of star-cross'd lovers take their life;\n\ +Whole misadventured piteous overthrows\n\ +Do with their death bury their parents' strife.\n\ +The fearful passage of their death-mark'd love,\n\ +And the continuance of their parents' rage,\n\ +Which, but their children's end, nought could remove,\n\ +Is now the two hours' traffic of our stage;\n\ +The which if you with patient ears attend,\n\ +What here shall miss, our toil shall strive to mend."; + +for (var i = 0; i <4; i++) { + plainText += plainText; +} + +var sha1Output = hex_sha1(plainText); diff --git a/SunSpider/tests/date-format-tofte.js b/SunSpider/tests/date-format-tofte.js new file mode 100644 index 0000000..66e2cef --- /dev/null +++ b/SunSpider/tests/date-format-tofte.js @@ -0,0 +1,299 @@ +function arrayExists(array, x) { + for (var i = 0; i < array.length; i++) { + if (array[i] == x) return true; + } + return false; +} + +Date.prototype.formatDate = function (input,time) { + // formatDate : + // a PHP date like function, for formatting date strings + // See: http://www.php.net/date + // + // input : format string + // time : epoch time (seconds, and optional) + // + // if time is not passed, formatting is based on + // the current "this" date object's set time. + // + // supported: + // a, A, B, d, D, F, g, G, h, H, i, j, l (lowercase L), L, + // m, M, n, O, r, s, S, t, U, w, W, y, Y, z + // + // unsupported: + // I (capital i), T, Z + + var switches = ["a", "A", "B", "d", "D", "F", "g", "G", "h", "H", + "i", "j", "l", "L", "m", "M", "n", "O", "r", "s", + "S", "t", "U", "w", "W", "y", "Y", "z"]; + var daysLong = ["Sunday", "Monday", "Tuesday", "Wednesday", + "Thursday", "Friday", "Saturday"]; + var daysShort = ["Sun", "Mon", "Tue", "Wed", + "Thu", "Fri", "Sat"]; + var monthsShort = ["Jan", "Feb", "Mar", "Apr", + "May", "Jun", "Jul", "Aug", "Sep", + "Oct", "Nov", "Dec"]; + var monthsLong = ["January", "February", "March", "April", + "May", "June", "July", "August", "September", + "October", "November", "December"]; + var daysSuffix = ["st", "nd", "rd", "th", "th", "th", "th", // 1st - 7th + "th", "th", "th", "th", "th", "th", "th", // 8th - 14th + "th", "th", "th", "th", "th", "th", "st", // 15th - 21st + "nd", "rd", "th", "th", "th", "th", "th", // 22nd - 28th + "th", "th", "st"]; // 29th - 31st + + function a() { + // Lowercase Ante meridiem and Post meridiem + return self.getHours() > 11? "pm" : "am"; + } + function A() { + // Uppercase Ante meridiem and Post meridiem + return self.getHours() > 11? "PM" : "AM"; + } + + function B(){ + // Swatch internet time. code simply grabbed from ppk, + // since I was feeling lazy: + // http://www.xs4all.nl/~ppk/js/beat.html + var off = (self.getTimezoneOffset() + 60)*60; + var theSeconds = (self.getHours() * 3600) + + (self.getMinutes() * 60) + + self.getSeconds() + off; + var beat = Math.floor(theSeconds/86.4); + if (beat > 1000) beat -= 1000; + if (beat < 0) beat += 1000; + if ((""+beat).length == 1) beat = "00"+beat; + if ((""+beat).length == 2) beat = "0"+beat; + return beat; + } + + function d() { + // Day of the month, 2 digits with leading zeros + return new String(self.getDate()).length == 1? + "0"+self.getDate() : self.getDate(); + } + function D() { + // A textual representation of a day, three letters + return daysShort[self.getDay()]; + } + function F() { + // A full textual representation of a month + return monthsLong[self.getMonth()]; + } + function g() { + // 12-hour format of an hour without leading zeros + return self.getHours() > 12? self.getHours()-12 : self.getHours(); + } + function G() { + // 24-hour format of an hour without leading zeros + return self.getHours(); + } + function h() { + // 12-hour format of an hour with leading zeros + if (self.getHours() > 12) { + var s = new String(self.getHours()-12); + return s.length == 1? + "0"+ (self.getHours()-12) : self.getHours()-12; + } else { + var s = new String(self.getHours()); + return s.length == 1? + "0"+self.getHours() : self.getHours(); + } + } + function H() { + // 24-hour format of an hour with leading zeros + return new String(self.getHours()).length == 1? + "0"+self.getHours() : self.getHours(); + } + function i() { + // Minutes with leading zeros + return new String(self.getMinutes()).length == 1? + "0"+self.getMinutes() : self.getMinutes(); + } + function j() { + // Day of the month without leading zeros + return self.getDate(); + } + function l() { + // A full textual representation of the day of the week + return daysLong[self.getDay()]; + } + function L() { + // leap year or not. 1 if leap year, 0 if not. + // the logic should match iso's 8601 standard. + var y_ = Y(); + if ( + (y_ % 4 == 0 && y_ % 100 != 0) || + (y_ % 4 == 0 && y_ % 100 == 0 && y_ % 400 == 0) + ) { + return 1; + } else { + return 0; + } + } + function m() { + // Numeric representation of a month, with leading zeros + return self.getMonth() < 9? + "0"+(self.getMonth()+1) : + self.getMonth()+1; + } + function M() { + // A short textual representation of a month, three letters + return monthsShort[self.getMonth()]; + } + function n() { + // Numeric representation of a month, without leading zeros + return self.getMonth()+1; + } + function O() { + // Difference to Greenwich time (GMT) in hours + var os = Math.abs(self.getTimezoneOffset()); + var h = ""+Math.floor(os/60); + var m = ""+(os%60); + h.length == 1? h = "0"+h:1; + m.length == 1? m = "0"+m:1; + return self.getTimezoneOffset() < 0 ? "+"+h+m : "-"+h+m; + } + function r() { + // RFC 822 formatted date + var r; // result + // Thu , 21 Dec 2000 + r = D() + ", " + j() + " " + M() + " " + Y() + + // 16 : 01 : 07 +0200 + " " + H() + ":" + i() + ":" + s() + " " + O(); + return r; + } + function S() { + // English ordinal suffix for the day of the month, 2 characters + return daysSuffix[self.getDate()-1]; + } + function s() { + // Seconds, with leading zeros + return new String(self.getSeconds()).length == 1? + "0"+self.getSeconds() : self.getSeconds(); + } + function t() { + + // thanks to Matt Bannon for some much needed code-fixes here! + var daysinmonths = [null,31,28,31,30,31,30,31,31,30,31,30,31]; + if (L()==1 && n()==2) return 29; // leap day + return daysinmonths[n()]; + } + function U() { + // Seconds since the Unix Epoch (January 1 1970 00:00:00 GMT) + return Math.round(self.getTime()/1000); + } + function W() { + // Weeknumber, as per ISO specification: + // http://www.cl.cam.ac.uk/~mgk25/iso-time.html + + // if the day is three days before newyears eve, + // there's a chance it's "week 1" of next year. + // here we check for that. + var beforeNY = 364+L() - z(); + var afterNY = z(); + var weekday = w()!=0?w()-1:6; // makes sunday (0), into 6. + if (beforeNY <= 2 && weekday <= 2-beforeNY) { + return 1; + } + // similarly, if the day is within threedays of newyears + // there's a chance it belongs in the old year. + var ny = new Date("January 1 " + Y() + " 00:00:00"); + var nyDay = ny.getDay()!=0?ny.getDay()-1:6; + if ( + (afterNY <= 2) && + (nyDay >=4) && + (afterNY >= (6-nyDay)) + ) { + // Since I'm not sure we can just always return 53, + // i call the function here again, using the last day + // of the previous year, as the date, and then just + // return that week. + var prevNY = new Date("December 31 " + (Y()-1) + " 00:00:00"); + return prevNY.formatDate("W"); + } + + // week 1, is the week that has the first thursday in it. + // note that this value is not zero index. + if (nyDay <= 3) { + // first day of the year fell on a thursday, or earlier. + return 1 + Math.floor( ( z() + nyDay ) / 7 ); + } else { + // first day of the year fell on a friday, or later. + return 1 + Math.floor( ( z() - ( 7 - nyDay ) ) / 7 ); + } + } + function w() { + // Numeric representation of the day of the week + return self.getDay(); + } + + function Y() { + // A full numeric representation of a year, 4 digits + + // we first check, if getFullYear is supported. if it + // is, we just use that. ppks code is nice, but wont + // work with dates outside 1900-2038, or something like that + if (self.getFullYear) { + var newDate = new Date("January 1 2001 00:00:00 +0000"); + var x = newDate .getFullYear(); + if (x == 2001) { + // i trust the method now + return self.getFullYear(); + } + } + // else, do this: + // codes thanks to ppk: + // http://www.xs4all.nl/~ppk/js/introdate.html + var x = self.getYear(); + var y = x % 100; + y += (y < 38) ? 2000 : 1900; + return y; + } + function y() { + // A two-digit representation of a year + var y = Y()+""; + return y.substring(y.length-2,y.length); + } + function z() { + // The day of the year, zero indexed! 0 through 366 + var t = new Date("January 1 " + Y() + " 00:00:00"); + var diff = self.getTime() - t.getTime(); + return Math.floor(diff/1000/60/60/24); + } + + var self = this; + if (time) { + // save time + var prevTime = self.getTime(); + self.setTime(time); + } + + var ia = input.split(""); + var ij = 0; + while (ia[ij]) { + if (ia[ij] == "\\") { + // this is our way of allowing users to escape stuff + ia.splice(ij,1); + } else { + if (arrayExists(switches,ia[ij])) { + ia[ij] = eval(ia[ij] + "()"); + } + } + ij++; + } + // reset time, back to what it was + if (prevTime) { + self.setTime(prevTime); + } + return ia.join(""); +} + +var date = new Date("1/1/2007 1:11:11"); + +for (i = 0; i < 500; ++i) { + var shortFormat = date.formatDate("Y-m-d"); + var longFormat = date.formatDate("l, F d, Y g:i:s A"); + date.setTime(date.getTime() + 84266956); +} + diff --git a/SunSpider/tests/date-format-xparb.js b/SunSpider/tests/date-format-xparb.js new file mode 100644 index 0000000..1f09556 --- /dev/null +++ b/SunSpider/tests/date-format-xparb.js @@ -0,0 +1,417 @@ +/* + * Copyright (C) 2004 Baron Schwartz + * + * This program is free software; you can redistribute it and/or modify it + * under the terms of the GNU Lesser General Public License as published by the + * Free Software Foundation, version 2.1. + * + * This program is distributed in the hope that it will be useful, but WITHOUT + * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS + * FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more + * details. + */ + +Date.parseFunctions = {count:0}; +Date.parseRegexes = []; +Date.formatFunctions = {count:0}; + +Date.prototype.dateFormat = function(format) { + if (Date.formatFunctions[format] == null) { + Date.createNewFormat(format); + } + var func = Date.formatFunctions[format]; + return this[func](); +} + +Date.createNewFormat = function(format) { + var funcName = "format" + Date.formatFunctions.count++; + Date.formatFunctions[format] = funcName; + var code = "Date.prototype." + funcName + " = function(){return "; + var special = false; + var ch = ''; + for (var i = 0; i < format.length; ++i) { + ch = format.charAt(i); + if (!special && ch == "\\") { + special = true; + } + else if (special) { + special = false; + code += "'" + String.escape(ch) + "' + "; + } + else { + code += Date.getFormatCode(ch); + } + } + eval(code.substring(0, code.length - 3) + ";}"); +} + +Date.getFormatCode = function(character) { + switch (character) { + case "d": + return "String.leftPad(this.getDate(), 2, '0') + "; + case "D": + return "Date.dayNames[this.getDay()].substring(0, 3) + "; + case "j": + return "this.getDate() + "; + case "l": + return "Date.dayNames[this.getDay()] + "; + case "S": + return "this.getSuffix() + "; + case "w": + return "this.getDay() + "; + case "z": + return "this.getDayOfYear() + "; + case "W": + return "this.getWeekOfYear() + "; + case "F": + return "Date.monthNames[this.getMonth()] + "; + case "m": + return "String.leftPad(this.getMonth() + 1, 2, '0') + "; + case "M": + return "Date.monthNames[this.getMonth()].substring(0, 3) + "; + case "n": + return "(this.getMonth() + 1) + "; + case "t": + return "this.getDaysInMonth() + "; + case "L": + return "(this.isLeapYear() ? 1 : 0) + "; + case "Y": + return "this.getFullYear() + "; + case "y": + return "('' + this.getFullYear()).substring(2, 4) + "; + case "a": + return "(this.getHours() < 12 ? 'am' : 'pm') + "; + case "A": + return "(this.getHours() < 12 ? 'AM' : 'PM') + "; + case "g": + return "((this.getHours() %12) ? this.getHours() % 12 : 12) + "; + case "G": + return "this.getHours() + "; + case "h": + return "String.leftPad((this.getHours() %12) ? this.getHours() % 12 : 12, 2, '0') + "; + case "H": + return "String.leftPad(this.getHours(), 2, '0') + "; + case "i": + return "String.leftPad(this.getMinutes(), 2, '0') + "; + case "s": + return "String.leftPad(this.getSeconds(), 2, '0') + "; + case "O": + return "this.getGMTOffset() + "; + case "T": + return "this.getTimezone() + "; + case "Z": + return "(this.getTimezoneOffset() * -60) + "; + default: + return "'" + String.escape(character) + "' + "; + } +} + +Date.parseDate = function(input, format) { + if (Date.parseFunctions[format] == null) { + Date.createParser(format); + } + var func = Date.parseFunctions[format]; + return Date[func](input); +} + +Date.createParser = function(format) { + var funcName = "parse" + Date.parseFunctions.count++; + var regexNum = Date.parseRegexes.length; + var currentGroup = 1; + Date.parseFunctions[format] = funcName; + + var code = "Date." + funcName + " = function(input){\n" + + "var y = -1, m = -1, d = -1, h = -1, i = -1, s = -1;\n" + + "var d = new Date();\n" + + "y = d.getFullYear();\n" + + "m = d.getMonth();\n" + + "d = d.getDate();\n" + + "var results = input.match(Date.parseRegexes[" + regexNum + "]);\n" + + "if (results && results.length > 0) {" + var regex = ""; + + var special = false; + var ch = ''; + for (var i = 0; i < format.length; ++i) { + ch = format.charAt(i); + if (!special && ch == "\\") { + special = true; + } + else if (special) { + special = false; + regex += String.escape(ch); + } + else { + obj = Date.formatCodeToRegex(ch, currentGroup); + currentGroup += obj.g; + regex += obj.s; + if (obj.g && obj.c) { + code += obj.c; + } + } + } + + code += "if (y > 0 && m >= 0 && d > 0 && h >= 0 && i >= 0 && s >= 0)\n" + + "{return new Date(y, m, d, h, i, s);}\n" + + "else if (y > 0 && m >= 0 && d > 0 && h >= 0 && i >= 0)\n" + + "{return new Date(y, m, d, h, i);}\n" + + "else if (y > 0 && m >= 0 && d > 0 && h >= 0)\n" + + "{return new Date(y, m, d, h);}\n" + + "else if (y > 0 && m >= 0 && d > 0)\n" + + "{return new Date(y, m, d);}\n" + + "else if (y > 0 && m >= 0)\n" + + "{return new Date(y, m);}\n" + + "else if (y > 0)\n" + + "{return new Date(y);}\n" + + "}return null;}"; + + Date.parseRegexes[regexNum] = new RegExp("^" + regex + "$"); + eval(code); +} + +Date.formatCodeToRegex = function(character, currentGroup) { + switch (character) { + case "D": + return {g:0, + c:null, + s:"(?:Sun|Mon|Tue|Wed|Thu|Fri|Sat)"}; + case "j": + case "d": + return {g:1, + c:"d = parseInt(results[" + currentGroup + "], 10);\n", + s:"(\\d{1,2})"}; + case "l": + return {g:0, + c:null, + s:"(?:" + Date.dayNames.join("|") + ")"}; + case "S": + return {g:0, + c:null, + s:"(?:st|nd|rd|th)"}; + case "w": + return {g:0, + c:null, + s:"\\d"}; + case "z": + return {g:0, + c:null, + s:"(?:\\d{1,3})"}; + case "W": + return {g:0, + c:null, + s:"(?:\\d{2})"}; + case "F": + return {g:1, + c:"m = parseInt(Date.monthNumbers[results[" + currentGroup + "].substring(0, 3)], 10);\n", + s:"(" + Date.monthNames.join("|") + ")"}; + case "M": + return {g:1, + c:"m = parseInt(Date.monthNumbers[results[" + currentGroup + "]], 10);\n", + s:"(Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec)"}; + case "n": + case "m": + return {g:1, + c:"m = parseInt(results[" + currentGroup + "], 10) - 1;\n", + s:"(\\d{1,2})"}; + case "t": + return {g:0, + c:null, + s:"\\d{1,2}"}; + case "L": + return {g:0, + c:null, + s:"(?:1|0)"}; + case "Y": + return {g:1, + c:"y = parseInt(results[" + currentGroup + "], 10);\n", + s:"(\\d{4})"}; + case "y": + return {g:1, + c:"var ty = parseInt(results[" + currentGroup + "], 10);\n" + + "y = ty > Date.y2kYear ? 1900 + ty : 2000 + ty;\n", + s:"(\\d{1,2})"}; + case "a": + return {g:1, + c:"if (results[" + currentGroup + "] == 'am') {\n" + + "if (h == 12) { h = 0; }\n" + + "} else { if (h < 12) { h += 12; }}", + s:"(am|pm)"}; + case "A": + return {g:1, + c:"if (results[" + currentGroup + "] == 'AM') {\n" + + "if (h == 12) { h = 0; }\n" + + "} else { if (h < 12) { h += 12; }}", + s:"(AM|PM)"}; + case "g": + case "G": + case "h": + case "H": + return {g:1, + c:"h = parseInt(results[" + currentGroup + "], 10);\n", + s:"(\\d{1,2})"}; + case "i": + return {g:1, + c:"i = parseInt(results[" + currentGroup + "], 10);\n", + s:"(\\d{2})"}; + case "s": + return {g:1, + c:"s = parseInt(results[" + currentGroup + "], 10);\n", + s:"(\\d{2})"}; + case "O": + return {g:0, + c:null, + s:"[+-]\\d{4}"}; + case "T": + return {g:0, + c:null, + s:"[A-Z]{3}"}; + case "Z": + return {g:0, + c:null, + s:"[+-]\\d{1,5}"}; + default: + return {g:0, + c:null, + s:String.escape(character)}; + } +} + +Date.prototype.getTimezone = function() { + return this.toString().replace( + /^.*? ([A-Z]{3}) [0-9]{4}.*$/, "$1").replace( + /^.*?\(([A-Z])[a-z]+ ([A-Z])[a-z]+ ([A-Z])[a-z]+\)$/, "$1$2$3"); +} + +Date.prototype.getGMTOffset = function() { + return (this.getTimezoneOffset() > 0 ? "-" : "+") + + String.leftPad(Math.floor(this.getTimezoneOffset() / 60), 2, "0") + + String.leftPad(this.getTimezoneOffset() % 60, 2, "0"); +} + +Date.prototype.getDayOfYear = function() { + var num = 0; + Date.daysInMonth[1] = this.isLeapYear() ? 29 : 28; + for (var i = 0; i < this.getMonth(); ++i) { + num += Date.daysInMonth[i]; + } + return num + this.getDate() - 1; +} + +Date.prototype.getWeekOfYear = function() { + // Skip to Thursday of this week + var now = this.getDayOfYear() + (4 - this.getDay()); + // Find the first Thursday of the year + var jan1 = new Date(this.getFullYear(), 0, 1); + var then = (7 - jan1.getDay() + 4); + document.write(then); + return String.leftPad(((now - then) / 7) + 1, 2, "0"); +} + +Date.prototype.isLeapYear = function() { + var year = this.getFullYear(); + return ((year & 3) == 0 && (year % 100 || (year % 400 == 0 && year))); +} + +Date.prototype.getFirstDayOfMonth = function() { + var day = (this.getDay() - (this.getDate() - 1)) % 7; + return (day < 0) ? (day + 7) : day; +} + +Date.prototype.getLastDayOfMonth = function() { + var day = (this.getDay() + (Date.daysInMonth[this.getMonth()] - this.getDate())) % 7; + return (day < 0) ? (day + 7) : day; +} + +Date.prototype.getDaysInMonth = function() { + Date.daysInMonth[1] = this.isLeapYear() ? 29 : 28; + return Date.daysInMonth[this.getMonth()]; +} + +Date.prototype.getSuffix = function() { + switch (this.getDate()) { + case 1: + case 21: + case 31: + return "st"; + case 2: + case 22: + return "nd"; + case 3: + case 23: + return "rd"; + default: + return "th"; + } +} + +String.escape = function(string) { + return string.replace(/('|\\)/g, "\\$1"); +} + +String.leftPad = function (val, size, ch) { + var result = new String(val); + if (ch == null) { + ch = " "; + } + while (result.length < size) { + result = ch + result; + } + return result; +} + +Date.daysInMonth = [31,28,31,30,31,30,31,31,30,31,30,31]; +Date.monthNames = + ["January", + "February", + "March", + "April", + "May", + "June", + "July", + "August", + "September", + "October", + "November", + "December"]; +Date.dayNames = + ["Sunday", + "Monday", + "Tuesday", + "Wednesday", + "Thursday", + "Friday", + "Saturday"]; +Date.y2kYear = 50; +Date.monthNumbers = { + Jan:0, + Feb:1, + Mar:2, + Apr:3, + May:4, + Jun:5, + Jul:6, + Aug:7, + Sep:8, + Oct:9, + Nov:10, + Dec:11}; +Date.patterns = { + ISO8601LongPattern:"Y-m-d H:i:s", + ISO8601ShortPattern:"Y-m-d", + ShortDatePattern: "n/j/Y", + LongDatePattern: "l, F d, Y", + FullDateTimePattern: "l, F d, Y g:i:s A", + MonthDayPattern: "F d", + ShortTimePattern: "g:i A", + LongTimePattern: "g:i:s A", + SortableDateTimePattern: "Y-m-d\\TH:i:s", + UniversalSortableDateTimePattern: "Y-m-d H:i:sO", + YearMonthPattern: "F, Y"}; + +var date = new Date("1/1/2007 1:11:11"); + +for (i = 0; i < 4000; ++i) { + var shortFormat = date.dateFormat("Y-m-d"); + var longFormat = date.dateFormat("l, F d, Y g:i:s A"); + date.setTime(date.getTime() + 84266956); +} diff --git a/SunSpider/tests/math-cordic.js b/SunSpider/tests/math-cordic.js new file mode 100644 index 0000000..4d3833b --- /dev/null +++ b/SunSpider/tests/math-cordic.js @@ -0,0 +1,95 @@ +/* + * Copyright (C) Rich Moore. All rights reserved. + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY CONTRIBUTORS ``AS IS'' AND ANY + * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + * PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR + * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, + * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, + * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR + * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY + * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE + * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + */ + +/////. Start CORDIC + +var AG_CONST = 0.6072529350; + +function FIXED(X) +{ + return X * 65536.0; +} + +function FLOAT(X) +{ + return X / 65536.0; +} + +function DEG2RAD(X) +{ + return 0.017453 * (X); +} + +var Angles = [ + FIXED(45.0), FIXED(26.565), FIXED(14.0362), FIXED(7.12502), + FIXED(3.57633), FIXED(1.78991), FIXED(0.895174), FIXED(0.447614), + FIXED(0.223811), FIXED(0.111906), FIXED(0.055953), + FIXED(0.027977) + ]; + + +function cordicsincos() { + var X; + var Y; + var TargetAngle; + var CurrAngle; + var Step; + + X = FIXED(AG_CONST); /* AG_CONST * cos(0) */ + Y = 0; /* AG_CONST * sin(0) */ + + TargetAngle = FIXED(28.027); + CurrAngle = 0; + for (Step = 0; Step < 12; Step++) { + var NewX; + if (TargetAngle > CurrAngle) { + NewX = X - (Y >> Step); + Y = (X >> Step) + Y; + X = NewX; + CurrAngle += Angles[Step]; + } else { + NewX = X + (Y >> Step); + Y = -(X >> Step) + Y; + X = NewX; + CurrAngle -= Angles[Step]; + } + } +} + +///// End CORDIC + +function cordic( runs ) { + var start = new Date(); + + for ( var i = 0 ; i < runs ; i++ ) { + cordicsincos(); + } + + var end = new Date(); + + return end.getTime() - start.getTime(); +} + +cordic(25000); diff --git a/SunSpider/tests/math-partial-sums.js b/SunSpider/tests/math-partial-sums.js new file mode 100644 index 0000000..d082d79 --- /dev/null +++ b/SunSpider/tests/math-partial-sums.js @@ -0,0 +1,33 @@ +// The Computer Language Shootout +// http://shootout.alioth.debian.org/ +// contributed by Isaac Gouy + +function partial(n){ + var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0; + var twothirds = 2.0/3.0; + var alt = -1.0; + var k2 = k3 = sk = ck = 0.0; + + for (var k = 1; k <= n; k++){ + k2 = k*k; + k3 = k2*k; + sk = Math.sin(k); + ck = Math.cos(k); + alt = -alt; + + a1 += Math.pow(twothirds,k-1); + a2 += Math.pow(k,-0.5); + a3 += 1.0/(k*(k+1.0)); + a4 += 1.0/(k3 * sk*sk); + a5 += 1.0/(k3 * ck*ck); + a6 += 1.0/k; + a7 += 1.0/k2; + a8 += alt/k; + a9 += alt/(2*k -1); + } +} + +for (var i = 1024; i <= 16384; i *= 2) { + partial(i); +} + diff --git a/SunSpider/tests/math-spectral-norm.js b/SunSpider/tests/math-spectral-norm.js new file mode 100644 index 0000000..8139ef3 --- /dev/null +++ b/SunSpider/tests/math-spectral-norm.js @@ -0,0 +1,51 @@ +// The Great Computer Language Shootout +// http://shootout.alioth.debian.org/ +// +// contributed by Ian Osgood + +function A(i,j) { + return 1/((i+j)*(i+j+1)/2+i+1); +} + +function Au(u,v) { + for (var i=0; i.*\n|\n/g,"") +clen = dnaInput.length + +var dnaOutputString; + +for(i in seqs) + dnaOutputString += seqs[i].source + " " + (dnaInput.match(seqs[i]) || []).length + "\n"; + // match returns null if no matches, so replace with empty + +for(k in subs) + dnaInput = dnaInput.replace(k, subs[k], "g") + // search string, replacement string, flags diff --git a/SunSpider/tests/string-base64.js b/SunSpider/tests/string-base64.js new file mode 100644 index 0000000..c9f3a7b --- /dev/null +++ b/SunSpider/tests/string-base64.js @@ -0,0 +1,135 @@ +/* ***** BEGIN LICENSE BLOCK ***** + * Version: MPL 1.1/GPL 2.0/LGPL 2.1 + * + * The contents of this file are subject to the Mozilla Public License Version + * 1.1 (the "License"); you may not use this file except in compliance with + * the License. You may obtain a copy of the License at + * http://www.mozilla.org/MPL/ + * + * Software distributed under the License is distributed on an "AS IS" basis, + * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License + * for the specific language governing rights and limitations under the + * License. + * + * The Original Code is Mozilla XML-RPC Client component. + * + * The Initial Developer of the Original Code is + * Digital Creations 2, Inc. + * Portions created by the Initial Developer are Copyright (C) 2000 + * the Initial Developer. All Rights Reserved. + * + * Contributor(s): + * Martijn Pieters (original author) + * Samuel Sieb + * + * Alternatively, the contents of this file may be used under the terms of + * either the GNU General Public License Version 2 or later (the "GPL"), or + * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"), + * in which case the provisions of the GPL or the LGPL are applicable instead + * of those above. If you wish to allow use of your version of this file only + * under the terms of either the GPL or the LGPL, and not to allow others to + * use your version of this file under the terms of the MPL, indicate your + * decision by deleting the provisions above and replace them with the notice + * and other provisions required by the GPL or the LGPL. If you do not delete + * the provisions above, a recipient may use your version of this file under + * the terms of any one of the MPL, the GPL or the LGPL. + * + * ***** END LICENSE BLOCK ***** */ + +// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956 + +/* Convert data (an array of integers) to a Base64 string. */ +var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/'; +var base64Pad = '='; + +function toBase64(data) { + var result = ''; + var length = data.length; + var i; + // Convert every three bytes to 4 ascii characters. + for (i = 0; i < (length - 2); i += 3) { + result += toBase64Table[data[i] >> 2]; + result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)]; + result += toBase64Table[((data[i+1] & 0x0f) << 2) + (data[i+2] >> 6)]; + result += toBase64Table[data[i+2] & 0x3f]; + } + + // Convert the remaining 1 or 2 bytes, pad out to 4 characters. + if (length%3) { + i = length - (length%3); + result += toBase64Table[data[i] >> 2]; + if ((length%3) == 2) { + result += toBase64Table[((data[i] & 0x03) << 4) + (data[i+1] >> 4)]; + result += toBase64Table[(data[i+1] & 0x0f) << 2]; + result += base64Pad; + } else { + result += toBase64Table[(data[i] & 0x03) << 4]; + result += base64Pad + base64Pad; + } + } + + return result; +} + +/* Convert Base64 data to a string */ +var toBinaryTable = [ + -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, + -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, + -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63, + 52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1, + -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9,10, 11,12,13,14, + 15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1, + -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40, + 41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1 +]; + +function base64ToString(data) { + var result = ''; + var leftbits = 0; // number of bits decoded, but yet to be appended + var leftdata = 0; // bits decoded, but yet to be appended + + // Convert one by one. + for (var i = 0; i < data.length; i++) { + var c = toBinaryTable[data.charCodeAt(i) & 0x7f]; + var padding = (data[i] == base64Pad); + // Skip illegal characters and whitespace + if (c == -1) continue; + + // Collect data into leftdata, update bitcount + leftdata = (leftdata << 6) | c; + leftbits += 6; + + // If we have 8 or more bits, append 8 bits to the result + if (leftbits >= 8) { + leftbits -= 8; + // Append if not padding. + if (!padding) + result += String.fromCharCode((leftdata >> leftbits) & 0xff); + leftdata &= (1 << leftbits) - 1; + } + } + + // If there are any bits left, the base64 string was corrupted + if (leftbits) + throw Components.Exception('Corrupted base64 string'); + + return result; +} + +var str = ""; + +for ( var i = 0; i < 8192; i++ ) + str += String.fromCharCode( (25 * Math.random()) + 97 ); + +for ( var i = 8192; i <= 16384; i *= 2 ) { + + var base64; + + base64 = toBase64(str); + base64ToString(base64); + + // Double the string + str += str; +} + +toBinaryTable = null; diff --git a/SunSpider/tests/string-fasta.js b/SunSpider/tests/string-fasta.js new file mode 100644 index 0000000..14a81f3 --- /dev/null +++ b/SunSpider/tests/string-fasta.js @@ -0,0 +1,85 @@ +// The Great Computer Language Shootout +// http://shootout.alioth.debian.org +// +// Contributed by Ian Osgood + +var last = 42, A = 3877, C = 29573, M = 139968; + +function rand(max) { + last = (last * A + C) % M; + return max * last / M; +} + +var ALU = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + +var IUB = { + a:0.27, c:0.12, g:0.12, t:0.27, + B:0.02, D:0.02, H:0.02, K:0.02, + M:0.02, N:0.02, R:0.02, S:0.02, + V:0.02, W:0.02, Y:0.02 +} + +var HomoSap = { + a: 0.3029549426680, + c: 0.1979883004921, + g: 0.1975473066391, + t: 0.3015094502008 +} + +function makeCumulative(table) { + var last = null; + for (var c in table) { + if (last) table[c] += table[last]; + last = c; + } +} + +function fastaRepeat(n, seq) { + var seqi = 0, lenOut = 60; + while (n>0) { + if (n0) { + if (n= 0x7f) { + validates = false; + break; + } + } + + if (!validates) + continue; + + var url = "http://example.com/tag/" + tag.replace(" ", "").toLowerCase(); + var popularity = tagInfo[i].popularity; + var color = 'rgb(' + Math.floor(255 * (popularity - 12) / 20) + ', 0, 255)'; + output += ' ' + tag + ' \n'; + } + + output += ''; + output.replace(" ", " "); + + return output; +} + +var tagcloud = makeTagCloud(tagInfo); +tagInfo = null; diff --git a/SunSpider/tests/string-unpack-code.js b/SunSpider/tests/string-unpack-code.js new file mode 100644 index 0000000..e6330f1 --- /dev/null +++ b/SunSpider/tests/string-unpack-code.js @@ -0,0 +1,68 @@ +// This test case unpacks the compressed code for the MochiKit, +// jQuery, Dojo and Prototype JavaScript libraries. + +/*** + MochiKit.MochiKit 1.3.1 : PACKED VERSION + THIS FILE IS AUTOMATICALLY GENERATED. If creating patches, please + diff against the source tree, not this file. + + See for documentation, downloads, license, etc. + + (c) 2005 Bob Ippolito. All rights Reserved. +***/ + +for (var i = 0; i < 2; i++) { + +var decompressedMochiKit = function(p,a,c,k,e,d){e=function(c){return(c35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)d[e(c)]=k[c]||e(c);k=[function(e){return d[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('if(H(1q)!="L"){1q.2X("B.J")}if(H(B)=="L"){B={}}if(H(B.J)=="L"){B.J={}}B.J.1Y="1.3.1";B.J.1r="B.J";B.J.2l=G(7V,vR){if(7V===O){7V={}}R(u i=1;i=0;i--){aw.e9(o[i])}}N{X.1c(o)}}F X},1R:G(7U,1i,av){if(!av){av=0}if(1i){u l=1i.K;if(H(l)!="2y"){if(H(B.15)!="L"){1i=B.15.2G(1i);l=1i.K}N{14 Y 3p("au 2E an at-as 3W B.15 2E ar")}}if(!7U){7U=[]}R(u i=av;i>b},vG:G(a,b){F a>>>b},eq:G(a,b){F a==b},ne:G(a,b){F a!=b},gt:G(a,b){F a>b},ge:G(a,b){F a>=b},lt:G(a,b){F al){7T=l}}69=[];R(i=0;i<7T;i++){u fa=[];R(u j=1;j0){ap=m.2o(me.am,ap)}u 4o=me.f7;if(!4o){4o=D}F me.f5.1w(4o,ap)};7Q.f7=f6;7Q.f5=ao;7Q.am=5f;F 7Q},lF:G(7P){u mp=B.J.1O;R(u k in 7P){u f4=7P[k];if(H(f4)=="G"){7P[k]=mp(f4,7P)}}},5u:G(mo,mn,ml,mk){B.J.ae.5M(mo,mn,ml,mk)},mj:{"5L":1h,"1n":1h,"2y":1h},2f:G(a,b){if(a==b){F 0}u f3=(H(a)=="L"||a===O);u f2=(H(b)=="L"||b===O);if(f3&&f2){F 0}N{if(f3){F-1}N{if(f2){F 1}}}u m=B.J;u f1=m.mj;if(!(H(a)in f1&&H(b)in f1)){1f{F m.ae.3C(a,b)}1e(e){if(e!=m.4d){14 e}}}if(ab){F 1}}u f0=m.U;14 Y 3p(f0(a)+" 3W "+f0(b)+" 9v 2E be vv")},eM:G(a,b){F B.J.2f(a.9P(),b.9P())},eL:G(a,b){u mi=B.J.2f;u 7O=a.K;u al=0;if(7O>b.K){al=1;7O=b.K}N{if(7O0))){u kv=B.S.d5(3s);3s=kv[0];68=kv[1]}N{if(M.K==1){u o=3s;3s=[];68=[];R(u k in o){u v=o[k];if(H(v)!="G"){3s.1c(k);68.1c(v)}}}}u W=[];u lT=28.2a(3s.K,68.K);u eT=B.J.af;R(u i=0;i=2J){14 I.25}5c+=3a;F W}}},4c:G(aa,p,q){u m=B.J;u I=B.15;u lb=m.2r(I.1Q,m.1R(O,M,1));u 2r=m.2r;u 1a=I.1a;F{U:G(){F"4c(...)"},1l:m.24("U"),1a:G(){F aa.1w(D,2r(1a,lb))}}},ep:G(aa,1V,I){1V=B.15.1Q(1V);u m=B.J;F{U:G(){F"ep(...)"},1l:m.24("U"),1a:G(){F aa.1w(I,1V.1a())}}},55:G(p,q){u I=B.15;u m=B.J;if(M.K==1){F I.1Q(M[0])}u 64=m.2r(I.1Q,M);F{U:G(){F"55(...)"},1l:m.24("U"),1a:G(){1M(64.K>1){1f{F 64[0].1a()}1e(e){if(e!=I.25){14 e}64.2P()}}if(64.K==1){u a9=64.2P();D.1a=m.1O("1a",a9);F D.1a()}14 I.25}}},9Z:G(3b,1V){u I=B.15;1V=I.1Q(1V);F{U:G(){F"9Z(...)"},1l:B.J.24("U"),1a:G(){u W=1V.1a();if(!3b(W)){D.1a=G(){14 I.25};D.1a()}F W}}},eo:G(3b,1V){1V=B.15.1Q(1V);u m=B.J;u 1O=m.1O;F{"U":G(){F"eo(...)"},"1l":m.24("U"),"1a":G(){1M(1h){u W=1V.1a();if(!3b(W)){2K}}D.1a=1O("1a",1V);F W}}},a7:G(63,2u,la){2u.62[63]=-1;u m=B.J;u l9=m.eI;F{U:G(){F"en("+63+", ...)"},1l:m.24("U"),1a:G(){u W;u i=2u.62[63];if(i==2u.29){W=la.1a();2u.a8.1c(W);2u.29+=1;2u.62[63]+=1}N{W=2u.a8[i-2u.2a];2u.62[63]+=1;if(i==2u.2a&&l9(2u.62)!=2u.2a){2u.2a+=1;2u.a8.2P()}}F W}}},en:G(a6,n){u W=[];u 2u={"62":[],"a8":[],"29":-1,"2a":-1};if(M.K==1){n=2}u I=B.15;a6=I.1Q(a6);u a7=I.a7;R(u i=0;i0&&4k>=2J)||(3a<0&&4k<=2J)){14 B.15.25}u W=4k;4k+=3a;F W},U:G(){F"7I("+[4k,2J,3a].2b(", ")+")"},1l:B.J.24("U")}},l0:G(a5,l7){u x=l7||0;u I=B.15;a5=I.1Q(a5);1f{1M(1h){x+=a5.1a()}}1e(e){if(e!=I.25){14 e}}F x},em:G(a4){u I=B.15;a4=I.1Q(a4);1f{1M(1h){a4.1a()}}1e(e){if(e!=I.25){14 e}}},9a:G(7J,1A,I){u m=B.J;if(M.K>2){1A=m.1O(1A,I)}if(m.3A(7J)){1f{R(u i=0;i<7J.K;i++){1A(7J[i])}}1e(e){if(e!=B.15.25){14 e}}}N{I=B.15;I.em(I.4c(1A,7J))}},kZ:G(l6,1A){u I=B.15;1f{I.a0(1A,l6).1a();F 1m}1e(e){if(e!=I.25){14 e}F 1h}},kY:G(l5,4j){u W=B.15.2G(l5);if(M.K==1){4j=B.J.2f}W.iz(4j);F W},kX:G(l4){u W=B.15.2G(l4);W.vg();F W},kW:G(l3,1A){u I=B.15;1f{I.a1(1A,l3).1a();F 1h}1e(e){if(e!=I.25){14 e}F 1m}},kV:G(1g,5b){if(B.J.3A(5b)){R(u i=0;i<5b.K;i++){1g.1c(5b[i])}}N{u I=B.15;5b=I.1Q(5b);1f{1M(1h){1g.1c(5b.1a())}}1e(e){if(e!=I.25){14 e}}}F 1g},ek:G(a3,eH){u m=B.J;u I=B.15;if(M.K<2){eH=m.4i.eE}a3=I.1Q(a3);u pk=L;u k=L;u v;G eF(){v=a3.1a();k=eH(v)}G l2(){u 7j=v;v=L;F 7j}u eG=1h;F{U:G(){F"ek(...)"},1a:G(){1M(k==pk){eF();if(eG){eG=1m;2K}}pk=k;F[k,{1a:G(){if(v==L){eF()}if(k!=pk){14 I.25}F l2()}}]}}},kU:G(a2,eD){u m=B.J;u I=B.15;if(M.K<2){eD=m.4i.eE}a2=I.1Q(a2);u ey=[];u eA=1h;u ez;1M(1h){1f{u eB=a2.1a();u 2h=eD(eB)}1e(e){if(e==I.25){2K}14 e}if(eA||2h!=ez){u eC=[];ey.1c([2h,eC])}eC.1c(eB);eA=1m;ez=2h}F ey},9X:G(ex){u i=0;F{U:G(){F"9X(...)"},1l:B.J.24("U"),1a:G(){if(i>=ex.K){14 B.15.25}F ex[i++]}}},eh:G(ew){F(ew&&H(ew.ei)=="G")},9V:G(l1){F{U:G(){F"9V(...)"},1l:B.J.24("U"),1a:G(){u W=l1.ei();if(W===O||W===L){14 B.15.25}F W}}}});B.15.1W=["9Y","9X","eh","9V",];B.15.1z=["25","9W","1Q","eu","et","7b","1a","es","a1","a0","er","4c","ep","55","9Z","eo","en","2G","7H","7I","l0","em","9a","kZ","kY","kX","kW","kV","ek","kU"];B.15.2d=G(){u m=B.J;D.25=Y m.5a("25");D.9Y=Y m.4a();D.9W("ej",m.3A,D.9X);D.9W("ei",D.eh,D.9V);D.2k={":3e":D.1z,":1p":m.2o(D.1z,D.1W)};m.3f(D)};B.15.2d();if(!B.3d){7H=B.15.7H}B.J.2Y(D,B.15);if(H(1q)!="L"){1q.2X("B.1H");1q.2M("B.J")}if(H(1x)!="L"){1x.26("B.J",[])}1f{if(H(B.J)=="L"){14""}}1e(e){14"B.1H 3F on B.J!"}if(H(B.1H)=="L"){B.1H={}}B.1H.1r="B.1H";B.1H.1Y="1.3.1";B.1H.1K=G(){F"["+D.1r+" "+D.1Y+"]"};B.1H.1l=G(){F D.1K()};B.1H.1z=["5C","49","7A","kR","2L","5Z","kG","ch","kE","kC"];B.1H.1W=["ef","e8","e7"];B.1H.49=G(1P,kT,3z){D.1P=1P;D.3N=kT;D.3z=3z;D.vf=Y 3Q()};B.1H.49.1U={U:G(){u m=B.J;F"49("+m.2r(m.U,[D.1P,D.3N,D.3z]).2b(", ")+")"},1l:B.J.24("U")};B.J.2l(B.1H,{ef:G(7F){u I=B.1H;if(H(7F)=="1n"){7F=I.5C[7F]}F G(1t){u 7G=1t.3N;if(H(7G)=="1n"){7G=I.5C[7G]}F 7G>=7F}},e8:G(){u kS=B.1H.49;R(u i=0;i=0&&D.4h.K>D.ec){D.4h.2P()}},c8:G(9U){u ea=0;if(!(H(9U)=="L"||9U===O)){ea=28.29(0,D.4h.K-9U)}F D.4h.9T(ea)},kJ:G(7B){if(H(7B)=="L"||7B===O){7B=30}u 9S=D.c8(7B);if(9S.K){u 1g=2r(G(m){F"\\n ["+m.1P+"] "+m.3N+": "+m.3z.2b(" ")},9S);1g.e9("va "+9S.K+" v9:");F 1g.2b("")}F""},v8:G(kI){if(H(B.1I)=="L"){cq(D.kJ())}N{B.1I.bY(kI||1m)}}};B.1H.2d=G(){D.5C={8M:40,8L:50,8K:30,8J:20,8I:10};u m=B.J;m.5u("49",D.e8,D.e7);u 61=m.2z;u e6=D.7A;u 60=e6.1U.kH;m.2l(D.7A.1U,{kF:61(60,"8I"),5Z:61(60,"8J"),dE:61(60,"8M"),kD:61(60,"8L"),kB:61(60,"8K")});u I=D;u 5Y=G(1b){F G(){I.2L[1b].1w(I.2L,M)}};D.5Z=5Y("5Z");D.kG=5Y("dE");D.ch=5Y("kF");D.kE=5Y("kD");D.kC=5Y("kB");D.2L=Y e6();D.2L.e5=1h;D.2k={":3e":D.1z,":1p":m.2o(D.1z,D.1W)};m.3f(D)};if(H(5X)=="L"&&H(2v)!="L"&&2v.kA&&H(kz)!="L"){5X=G(){5X.3G=M;u ev=2v.kA("v7");ev.v6("5X",1m,1h);kz(ev)}}B.1H.2d();B.J.2Y(D,B.1H);if(H(1q)!="L"){1q.2X("B.1D")}if(H(B)=="L"){B={}}if(H(B.1D)=="L"){B.1D={}}B.1D.1r="B.1D";B.1D.1Y="1.3.1";B.1D.1K=G(){F"["+D.1r+" "+D.1Y+"]"};B.1D.1l=G(){F D.1K()};B.1D.ks=G(1y){1y=1y+"";if(H(1y)!="1n"||1y.K===0){F O}u 7z=1y.2R("-");if(7z.K===0){F O}F Y 3Q(7z[0],7z[1]-1,7z[2])};B.1D.ky=/(\\d{4,})(?:-(\\d{1,2})(?:-(\\d{1,2})(?:[T ](\\d{1,2}):(\\d{1,2})(?::(\\d{1,2})(?:\\.(\\d+))?)?(?:(Z)|([+-])(\\d{1,2})(?::(\\d{1,2}))?)?)?)?)?/;B.1D.kr=G(1y){1y=1y+"";if(H(1y)!="1n"||1y.K===0){F O}u X=1y.3C(B.1D.ky);if(H(X)=="L"||X===O){F O}u 5W,7y,7x,9R,2a,9Q,7w;5W=3w(X[1],10);if(H(X[2])=="L"||X[2]===""){F Y 3Q(5W)}7y=3w(X[2],10)-1;7x=3w(X[3],10);if(H(X[4])=="L"||X[4]===""){F Y 3Q(5W,7y,7x)}9R=3w(X[4],10);2a=3w(X[5],10);9Q=(H(X[6])!="L"&&X[6]!=="")?3w(X[6],10):0;if(H(X[7])!="L"&&X[7]!==""){7w=28.ha(c5*4M("0."+X[7]))}N{7w=0}if((H(X[8])=="L"||X[8]==="")&&(H(X[9])=="L"||X[9]==="")){F Y 3Q(5W,7y,7x,9R,2a,9Q,7w)}u 58;if(H(X[9])!="L"&&X[9]!==""){58=3w(X[10],10)*v5;if(H(X[11])!="L"&&X[11]!==""){58+=3w(X[11],10)*kw}if(X[9]=="-"){58=-58}}N{58=0}F Y 3Q(3Q.v4(5W,7y,7x,9R,2a,9Q,7w)-58)};B.1D.dY=G(2g,kx){if(H(2g)=="L"||2g===O){F O}u hh=2g.v3();u mm=2g.v2();u ss=2g.v1();u 1g=[((kx&&(hh<10))?"0"+hh:hh),((mm<10)?"0"+mm:mm),((ss<10)?"0"+ss:ss)];F 1g.2b(":")};B.1D.kq=G(2g,7v){if(H(2g)=="L"||2g===O){F O}u ku=7v?"T":" ";u kt=7v?"Z":"";if(7v){2g=Y 3Q(2g.9P()+(2g.v0()*kw))}F B.1D.dX(2g)+ku+B.1D.dY(2g,7v)+kt};B.1D.dX=G(2g){if(H(2g)=="L"||2g===O){F O}u e4=B.1D.e3;F[2g.dZ(),e4(2g.e1()+1),e4(2g.e0())].2b("-")};B.1D.kp=G(d){d=d+"";if(H(d)!="1n"||d.K===0){F O}u a=d.2R("/");F Y 3Q(a[2],a[0]-1,a[1])};B.1D.e3=G(n){F(n>9)?n:"0"+n};B.1D.ko=G(d){if(H(d)=="L"||d===O){F O}u e2=B.1D.e3;F[e2(d.e1()+1),e2(d.e0()),d.dZ()].2b("/")};B.1D.kn=G(d){if(H(d)=="L"||d===O){F O}F[d.e1()+1,d.e0(),d.dZ()].2b("/")};B.1D.1z=["ks","kr","dY","kq","dX","kp","ko","kn"];B.1D.1W=[];B.1D.2k={":3e":B.1D.1z,":1p":B.1D.1z};B.1D.2d=G(){u 2w=D.1r+".";R(u k in D){u o=D[k];if(H(o)=="G"&&H(o.1r)=="L"){1f{o.1r=2w+k}1e(e){}}}};B.1D.2d();if(H(B.J)!="L"){B.J.2Y(D,B.1D)}N{(G(km,dW){if((H(1x)=="L"&&H(1q)=="L")||(H(B.3d)=="5L"&&B.3d)){u 1p=dW.2k[":1p"];R(u i=0;i<1p.K;i++){km[1p[i]]=dW[1p[i]]}}})(D,B.1D)}if(H(1q)!="L"){1q.2X("B.1s")}if(H(B)=="L"){B={}}if(H(B.1s)=="L"){B.1s={}}B.1s.1r="B.1s";B.1s.1Y="1.3.1";B.1s.1K=G(){F"["+D.1r+" "+D.1Y+"]"};B.1s.1l=G(){F D.1K()};B.1s.ke=G(kl,kk,kj,ki,kh,dV,kg,9N,kf){F G(1P){1P=4M(1P);if(H(1P)=="L"||1P===O||k8(1P)){F kl}u 9L=kk;u 9K=kj;if(1P<0){1P=-1P}N{9L=9L.23(/-/,"")}u me=M.2U;u 9M=B.1s.dJ(ki);if(kh){1P=1P*3k;9K=9M.9y+9K}1P=B.1s.dK(1P,dV);u 9O=1P.2R(/\\./);u 3r=9O[0];u 3P=(9O.K==1)?"":9O[1];u X="";1M(3r.K9N){u i=3r.K-9N;X=9M.9A+3r.2W(i,3r.K)+X;3r=3r.2W(0,i)}}X=3r+X;if(dV>0){1M(3P.K=0)){D.9u()}},jR:G(X){D.9x(X);D.jX()},9x:G(X){D.2H=((X 2C 2x)?1:0);D.53[D.2H]=X;D.9u()},dD:G(){if(D.2H!=-1){if(!D.7l){14 Y B.1k.dj(D)}D.7l=1m;F}},3o:G(X){D.dD();if(X 2C B.1k.2t){14 Y 2x("2t jW 9v aB be 7r if jV jU jT jS of a 3o")}D.9x(X)},52:G(X){D.dD();u I=B.1k;if(X 2C I.2t){14 Y 2x("2t jW 9v aB be 7r if jV jU jT jS of a 3o")}if(!(X 2C 2x)){X=Y I.9p(X)}D.9x(X)},jP:G(fn){if(M.K>1){fn=B.J.2z.1w(O,M)}F D.9w(fn,fn)},5Q:G(fn){if(M.K>1){fn=B.J.2z.1w(O,M)}F D.9w(fn,O)},jA:G(fn){if(M.K>1){fn=B.J.2z.1w(O,M)}F D.9w(O,fn)},9w:G(cb,eb){if(D.7r){14 Y 2x("uQ uP 9v 2E be re-uO")}D.55.1c([cb,eb]);if(D.2H>=0){D.9u()}F D},9u:G(){u dC=D.55;u 56=D.2H;u X=D.53[56];u I=D;u cb=O;1M(dC.K>0&&D.54===0){u 2n=dC.2P();u f=2n[56];if(f===O){2V}1f{X=f(X);56=((X 2C 2x)?1:0);if(X 2C B.1k.2t){cb=G(X){I.jR(X)};D.jQ()}}1e(3O){56=1;if(!(3O 2C 2x)){3O=Y B.1k.9p(3O)}X=3O}}D.2H=56;D.53[56]=X;if(cb&&D.54){X.jP(cb);X.7r=1h}}};B.J.2l(B.1k,{dk:G(){F dB("("+M[0].jN+")")},dp:G(uN){u d=Y B.1k.2t();d.3o.1w(d,M);F d},9q:G(uM){u d=Y B.1k.2t();d.52.1w(d,M);F d},do:G(){u I=M.2U;if(!I.7q){u dy=[G(){F Y 7q()},G(){F Y dA("jO.dz")},G(){F Y dA("uL.dz")},G(){F Y dA("jO.dz.4.0")},G(){14 Y B.1k.dh("uK uJ 2E uI 7q")}];R(u i=0;i1){u m=B.J;u qs=m.dw.1w(O,m.1R(O,M,1));if(qs){5F+="?"+qs}}2s.cp("uB",5F,1h);F I.dl(2s)},jv:G(5F){u I=B.1k;u d=I.dn.1w(I,M);d=d.5Q(I.dk);F d},dm:G(jJ,dv){u d=Y B.1k.2t();u m=B.J;if(H(dv)!="L"){d.5Q(G(){F dv})}u jI=uA(m.1O("3o",d),28.8B(jJ*c5));d.7m=G(){1f{uz(jI)}1e(e){}};F d},ju:G(jH,1A){u m=B.J;u jG=m.2z.1w(m,m.1R(O,M,1));F B.1k.dm(jH).5Q(G(X){F jG()})}});B.1k.5O=G(){D.5S=[];D.4e=1m;D.id=D.7n()};B.1k.5O.1U={bX:B.1k.5O,uy:G(){d=Y B.1k.2t();if(D.4e){D.5S.1c(d)}N{D.4e=1h;d.3o(D)}F d},jF:G(){if(!D.4e){14 3p("ux to jF an jE 5O")}D.4e=1m;if(D.5S.K>0){D.4e=1h;D.5S.2P().3o(D)}},7n:B.J.4f(),U:G(){u 9t;if(D.4e){9t="4e, "+D.5S.K+" 5S"}N{9t="jE"}F"5O("+D.id+", "+9t+")"},1l:B.J.24("U")};B.1k.7i=G(2G,du,jC,jB,jD){D.2G=2G;D.9r=Y 7o(D.2G.K);D.55=[];D.id=D.7n();D.2H=-1;D.54=0;D.53=[O,O];D.7m=jD;D.7l=1m;if(D.2G.K===0&&!du){D.3o(D.9r)}D.dr=0;D.jz=du;D.jy=jC;D.jx=jB;u 9s=0;B.J.2r(B.J.1O(G(d){d.5Q(B.J.1O(D.dt,D),9s,1h);d.jA(B.J.1O(D.dt,D),9s,1m);9s+=1},D),D.2G)};B.J.2l(B.1k.7i.1U,B.1k.2t.1U);B.J.2l(B.1k.7i.1U,{dt:G(ds,7k,5R){D.9r[ds]=[7k,5R];D.dr+=1;if(D.2H!==0){if(7k&&D.jz){D.3o([ds,5R])}N{if(!7k&&D.jy){D.52(5R)}N{if(D.dr==D.2G.K){D.3o(D.9r)}}}}if(!7k&&D.jx){5R=O}F 5R}});B.1k.jt=G(jw){u d=Y B.1k.7i(jw,1m,1h,1m);d.5Q(G(dq){u 7j=[];R(u i=0;i=0){u 9m=Q.1S[Q.j4];7d.1c(1b);7c.1c((9m.3m)?9m.3m:9m.7X);F O}7d.1c(1b);7c.1c("");F O}if(4Y=="cu"||4Y=="P"||4Y=="8d"||4Y=="6m"){F Q.5h}7d.1c(1b);7c.1c(Q.3m||"");F O}F Q.5h});F[7d,7c]},94:G(1N,1A){u I=B.S;u d3=I.1Z;u W;1f{I.1Z=1N;W=1A()}1e(e){I.1Z=d3;14 e}I.1Z=d3;F W},j3:G(1b,j2,3y,j1){B.S.9b.5M(1b,j2,3y,j1)},9k:G(1j,7a){u im=B.15;u I=B.S;u 1Q=im.1Q;u iY=im.7b;u 4c=im.4c;u iX=I.9b;u iZ=I.9k;u iW=B.J.4d;1M(1h){if(H(1j)=="L"||1j===O){F O}if(H(1j.3T)!="L"&&1j.3T>0){F 1j}if(H(1j)=="2y"||H(1j)=="5L"){1j=1j.1l()}if(H(1j)=="1n"){F I.1Z.4S(1j)}if(H(1j.j0)=="G"){1j=1j.j0(7a);2V}if(H(1j)=="G"){1j=1j(7a);2V}u 9l=O;1f{9l=1Q(1j)}1e(e){}if(9l){F 4c(iZ,9l,iY(7a))}1f{1j=iX.3C(1j,7a);2V}1e(e){if(e!=iW){14 e}}F I.1Z.4S(1j.1l())}F L},iV:G(1j,79,iU){u o={};o[79]=iU;1f{F B.S.4X(1j,o)}1e(e){}F O},iT:G(1j,79){u I=B.S;u d2=I.4U.99[79];1j=I.1E(1j);1f{if(d2){F 1j[d2]}F 1j.fm(79)}1e(e){}F O},4X:G(1j,5K){u Q=1j;u I=B.S;if(H(1j)=="1n"){Q=I.1E(1j)}if(5K){u d0=B.J.8Z;if(I.4U.6X){R(u k in 5K){u v=5K[k];if(H(v)=="3n"&&H(Q[k])=="3n"){d0(Q[k],v)}N{if(k.2W(0,2)=="on"){if(H(v)=="1n"){v=Y cZ(v)}Q[k]=v}N{Q.4p(k,v)}}}}N{u iS=I.4U.99;R(k in 5K){v=5K[k];u d1=iS[k];if(k=="1T"&&H(v)=="1n"){Q.1T.3x=v}N{if(H(d1)=="1n"){Q[d1]=v}N{if(H(Q[k])=="3n"&&H(v)=="3n"){d0(Q[k],v)}N{if(k.2W(0,2)=="on"){if(H(v)=="1n"){v=Y cZ(v)}Q[k]=v}N{Q.4p(k,v)}}}}}}}F Q},9j:G(1j){u Q=1j;u I=B.S;if(H(1j)=="1n"){Q=I.1E(1j)}u 78=[I.9k(B.J.1R(O,M,1),Q)];u iR=B.J.2o;1M(78.K){u n=78.2P();if(H(n)=="L"||n===O){}N{if(H(n.3T)=="2y"){Q.2c(n)}N{78=iR(n,78)}}}F Q},iQ:G(1j){u Q=1j;u I=B.S;if(H(1j)=="1n"){Q=I.1E(1j);M[0]=Q}u cY;1M((cY=Q.6n)){Q.6S(cY)}if(M.K<2){F Q}N{F I.9j.1w(D,M)}},cX:G(1b,4b){u Q;u I=B.S;u m=B.J;if(H(4b)=="1n"||H(4b)=="2y"){u 3G=m.1R([1b,O],M,1);F M.2U.1w(D,3G)}if(H(1b)=="1n"){if(4b&&"1b"in 4b&&!I.4U.6X){1b=("<"+1b+" 1b=\\""+I.9c(4b.1b)+"\\">")}Q=I.1Z.2S(1b)}N{Q=1b}if(4b){I.4X(Q,4b)}if(M.K<=2){F Q}N{u 3G=m.1R([Q],M,2);F I.9j.1w(D,3G)}},cw:G(){u m=B.J;F m.2z.1w(D,m.1R([B.S.cX],M))},cs:G(5J,1d){u I=B.S;5J=I.1E(5J);u cW=5J.3t;if(1d){1d=I.1E(1d);cW.uj(1d,5J)}N{cW.6S(5J)}F 1d},1E:G(id){u I=B.S;if(M.K==1){F((H(id)=="1n")?I.1Z.hN(id):id)}N{F B.J.2r(I.1E,M)}},4q:G(iP,cV,cU){if(M.K==2){cU=cV}u I=B.S;u el=I.1E(iP);u 77=I.1Z;if(!el||el==77){F L}if(el.iO){F el.iO[cV]}if(H(77.5k)=="L"){F L}if(77.5k===O){F L}u 9i=77.5k.g4(el,O);if(H(9i)=="L"||9i===O){F L}F 9i.6q(cU)},aH:G(76,9g,4W){u I=B.S;if(H(76)=="L"||76===O){76="*"}if(H(4W)=="L"||4W===O){4W=I.1Z}4W=I.1E(4W);u 9h=(4W.fr(76)||I.1Z.1p);if(H(9g)=="L"||9g===O){F B.J.1R(O,9h)}u cR=[];R(u i=0;i<9h.K;i++){u cS=9h[i];u cT=cS.3M.2R(" ");R(u j=0;j/g,">")},iB:G(2q){F B.S.cG(2q).2b("")},cG:G(2q,1g){if(H(1g)=="L"||1g===O){1g=[]}u 70=[2q];u I=B.S;u cB=I.9c;u iA=I.4U;1M(70.K){2q=70.hP();if(H(2q)=="1n"){1g.1c(2q)}N{if(2q.3T==1){1g.1c("<"+2q.cD.8G());u 71=[];u cF=iA(2q);R(u i=0;i");70.1c("");u cC=2q.5h;R(i=cC.K-1;i>=0;i--){70.1c(cC[i])}}N{1g.1c("/>")}}N{if(2q.3T==3){1g.1c(cB(2q.iv))}}}}F 1g},97:G(ix,cA){u m=B.J;u iy=m.1R(O,M,1);B.15.9a(m.47(O,m.2r(B.S.1E,iy)),G(cA){cA.1T.3u=ix})},iw:G(1j,iu){u W=[];(G(1j){u cn=1j.5h;if(cn){R(u i=0;i0){u it=m.47;2T=G(1j){F it(2T.ir,1j.6Y)};2T.cx={};B.15.9a(6Z.6Y,G(a){2T.cx[a.1b]=a.3m});2T.ir=G(a){F(2T.cx[a.1b]!=a.3m)};2T.6X=1m;2T.99={"iq":"3M","ip":"ud","uc":"ub","R":"u9"}}N{2T=G(1j){F 1j.6Y};2T.6X=1h;2T.99={}}D.4U=2T;u 1C=D.cw;D.io=1C("ul");D.il=1C("ol");D.ik=1C("li");D.ij=1C("td");D.cm=1C("tr");D.ii=1C("u8");D.ih=1C("u7");D.ig=1C("u6");D.ie=1C("u5");D.ic=1C("th");D.cv=1C("ck");D.8d=1C("cj");D.A=1C("a");D.6m=1C("4u");D.ib=1C("u4");D.ia=1C("2e");D.i9=1C("tt");D.i8=1C("4O");D.i7=1C("h1");D.i6=1C("h2");D.i5=1C("h3");D.i4=1C("br");D.i3=1C("hr");D.i2=1C("u3");D.i1=1C("u2");D.cu=1C("u1");D.P=1C("p");D.ct=1C("u0");D.i0=1C("hJ");D.hZ=1C("tZ");D.hY=1C("tY");D.hX=1C("tX");D.hW=1C("tW");D.hV=1C("tV");D.hU=m.2z(D.97,"98");D.hT=m.2z(D.97,"8c");D.hS=D.cs;D.$=D.1E;D.2k={":3e":D.1z,":1p":m.2o(D.1z,D.1W)};m.3f(D)}});B.S.2d(((H(2O)=="L")?D:2O));if(!B.3d){95=B.S.95;94=B.S.94}B.J.2Y(D,B.S);if(H(1q)!="L"){1q.2X("B.1I");1q.2M("B.1H");1q.2M("B.J")}if(H(1x)!="L"){1x.26("B.1H",[]);1x.26("B.J",[])}1f{if(H(B.J)=="L"||H(B.1H)=="L"){14""}}1e(e){14"B.1I 3F on B.J 3W B.1H!"}if(H(B.1I)=="L"){B.1I={}}B.1I.1r="B.1I";B.1I.1Y="1.3.1";B.1I.1K=G(){F"["+D.1r+" "+D.1Y+"]"};B.1I.1l=G(){F D.1K()};B.1I.bY=G(6W){u m=B.1I;6W=!(!6W);if(m.3l&&m.3l.8Q!=6W){m.3l.hA();m.3l=O}if(!m.3l||m.3l.8P){m.3l=Y m.1I(6W,B.1H.2L)}F m.3l};B.1I.1I=G(4R,6V){if(H(6V)=="L"||6V===O){6V=B.1H.2L}D.2L=6V;u tU=B.J.2l;u c3=B.J.8Z;u 1O=B.J.1O;u hM=B.J.4L;u 2m=2O;u 6U="tT";if(H(B.S)!="L"){2m=B.S.cr()}if(!4R){u 5F=2m.tS.tR.2R("?")[0].23(/[:\\/.><&]/g,"hR");u 1b=6U+"hR"+5F;u 5D=2m.cp("",1b,"tQ,tP,3V=hQ");if(!5D){cq("tO tN to cp tM 2O tL to hP-up tK.");F L}5D.2v.fl(""+"<5E><8Y>[B.1I]"+"<5s>");5D.2v.hG();5D.2v.8Y+=" "+2m.2v.8Y;2m=5D}u 1N=2m.2v;D.1N=1N;u 21=1N.hN(6U);u c4=!!21;if(21&&H(21.5B)!="L"){21.5B.2L=D.2L;21.5B.6K();F 21.5B}if(c4){u cl;1M((cl=21.6n)){21.6S(cl)}}N{21=1N.2S("4u");21.id=6U}21.5B=D;u 8T=1N.2S("ck");u 8S=1N.2S("ck");u 6O=1N.2S("2e");u 6N=1N.2S("2e");u 6M=1N.2S("2e");u 6L=1N.2S("2e");u 3L=1N.2S("4u");u 42=1N.2S("4u");u 8U=6U+"tz";D.8N=hM(D.8N);u 4T=[];u 6R=O;u cf=G(1t){u 6T=1t.3N;if(H(6T)=="2y"){6T=B.1H.5C[6T]}F 6T};u cd=G(1t){F 1t.3z.2b(" ")};u ca=1O(G(1t){u 8W=cf(1t);u 7X=cd(1t);u c=D.8N[8W];u p=1N.2S("cj");p.3M="B-49 B-5C-"+8W;p.1T.3x="ty: 2N; 4F-8X: -hL-4O-3y; 4F-8X: -o-4O-3y; 4F-8X: 4O-3y; 4F-8X: 4O-tx; hK-3y: 2K-hK; 3y-hJ: tw; 3U: "+c;p.2c(1N.4S(8W+": "+7X));42.2c(p);42.2c(1N.2S("br"));if(3L.ci>3L.hI){3L.4C=0}N{3L.4C=3L.hI}},D);u hD=G(1t){4T[4T.K]=1t;ca(1t)};u hF=G(){u cg,ce;1f{cg=Y 8V(8T.3m);ce=Y 8V(8S.3m)}1e(e){ch("2x in 47 tv: "+e.43);F O}F G(1t){F(cg.hH(cf(1t))&&ce.hH(cd(1t)))}};u cc=G(){1M(42.6n){42.6S(42.6n)}};u hB=G(){4T=[];cc()};u bZ=1O(G(){if(D.8P){F}D.8P=1h;if(B.1I.3l==D){B.1I.3l=O}D.2L.c9(8U);21.5B=O;if(4R){21.3t.6S(21)}N{D.2m.hG()}},D);u c7=G(){cc();R(u i=0;i<4T.K;i++){u 1t=4T[i];if(6R===O||6R(1t)){ca(1t)}}};D.6K=G(){6R=hF();c7();D.2L.c9(8U);D.2L.hE(8U,6R,hD)};u c0=1O(G(){4T=D.2L.c8();c7()},D);u c2=1O(G(6Q){6Q=6Q||2O.6D;2h=6Q.6w||6Q.8t;if(2h==13){D.6K()}},D);u 31="3u: 8c; z-c6: c5; 2I: 2N; 6f: 2N; 6P: tu; 5A: 3k%; he-3U: 4F; c1: "+D.8O;if(4R){31+="; 3V: ts; 3E-3D: fO 8a 8y"}N{31+="; 3V: 3k%;"}21.1T.3x=31;if(!c4){1N.5s.2c(21)}31={"3x":"5A: 33%; 3u: 8Q; c1: "+D.8O};c3(8T,{"3m":"8L|8M|8K|8J|8I","hC":c2,"1T":31});21.2c(8T);c3(8S,{"3m":".*","hC":c2,"1T":31});21.2c(8S);31="5A: 8%; 3u:8Q; c1: "+D.8O;6O.2c(1N.4S("tq"));6O.8R=1O("6K",D);6O.1T.3x=31;21.2c(6O);6N.2c(1N.4S("tp"));6N.8R=c0;6N.1T.3x=31;21.2c(6N);6M.2c(1N.4S("tn"));6M.8R=hB;6M.1T.3x=31;21.2c(6M);6L.2c(1N.4S("tm"));6L.8R=bZ;6L.1T.3x=31;21.2c(6L);3L.1T.3x="fS: tk; 5A: 3k%";42.1T.3x="5A: 3k%; 3V: "+(4R?"tj":"3k%");3L.2c(42);21.2c(3L);D.6K();c0();if(4R){D.2m=L}N{D.2m=2m}D.8Q=4R;D.hA=bZ;D.8P=1m;F D};B.1I.1I.1U={"8O":"ti tg,tf-te","8N":{"8M":"1v","8L":"gU","8K":"1F","8J":"8y","8I":"bx"}};B.1I.1W=["1I"];B.1I.1z=["bY"];B.1I.2d=G(){D.2k={":3e":D.1z,":1p":B.J.2o(D.1z,D.1W)};B.J.3f(D);B.1I.3l=O};B.1I.2d();B.J.2Y(D,B.1I);if(H(1q)!="L"){1q.2X("B.V");1q.2M("B.J")}if(H(1x)!="L"){1x.26("B.J",[])}1f{if(H(B.J)=="L"){14""}}1e(e){14"B.V 3F on B.J"}if(H(B.V)=="L"){B.V={}}B.V.1r="B.V";B.V.1Y="1.3.1";B.V.1K=G(){F"["+D.1r+" "+D.1Y+"]"};B.V.1l=G(){F D.1K()};B.V.V=G(1v,hz,1F,6J){if(H(6J)=="L"||6J===O){6J=1}D.1B={r:1v,g:hz,b:1F,a:6J}};B.V.V.1U={bX:B.V.V,tc:G(hy){u 1B=D.1B;u m=B.V;F m.V.3Y(1B.r,1B.g,1B.b,hy)},tb:G(1o){u 1G=D.41();1G.h=1o;u m=B.V;F m.V.4H(1G)},ta:G(hx){u 1G=D.41();1G.s=hx;u m=B.V;F m.V.4H(1G)},t9:G(hw){u 1G=D.41();1G.l=hw;u m=B.V;F m.V.4H(1G)},t8:G(hv){u 1G=D.41();1G.l=28.29(1G.l-hv,0);u m=B.V;F m.V.4H(1G)},t7:G(hu){u 1G=D.41();1G.l=28.2a(1G.l+hu,1);u m=B.V;F m.V.4H(1G)},fJ:G(ht,5z){if(H(5z)=="L"||5z===O){5z=0.5}u sf=1-5z;u s=D.1B;u d=ht.1B;u df=5z;F B.V.V.3Y((s.r*sf)+(d.r*df),(s.g*sf)+(d.g*df),(s.b*sf)+(d.b*df),(s.a*sf)+(d.a*df))},h4:G(hs){u a=D.6r();u b=hs.6r();F B.J.2f([a.r,a.g,a.b,a.a],[b.r,b.g,b.b,b.a])},hq:G(){F D.41().b>0.5},t6:G(){F(!D.hq())},t5:G(){u c=D.41();u 2Z=B.V.6F;u W=D.ho;if(!W){u 5y=(2Z(c.h,bF).6I(0)+","+2Z(c.s,3k).hp(4)+"%"+","+2Z(c.l,3k).hp(4)+"%");u a=c.a;if(a>=1){a=1;W="1G("+5y+")"}N{if(a<=0){a=0}W="t4("+5y+","+a+")"}D.ho=W}F W},hl:G(){u c=D.1B;u 2Z=B.V.6F;u W=D.hn;if(!W){u 5y=(2Z(c.r,3h).6I(0)+","+2Z(c.g,3h).6I(0)+","+2Z(c.b,3h).6I(0));if(c.a!=1){W="t3("+5y+","+c.a+")"}N{W="1B("+5y+")"}D.hn=W}F W},6r:G(){F B.J.4L(D.1B)},t2:G(){u m=B.V;u c=D.1B;u 2Z=B.V.6F;u W=D.hm;if(!W){W=("#"+m.6E(2Z(c.r,3h))+m.6E(2Z(c.g,3h))+m.6E(2Z(c.b,3h)));D.hm=W}F W},t1:G(){u 2Q=D.2Q;u c=D.1B;if(H(2Q)=="L"||2Q===O){2Q=B.V.bA(D.1B);D.2Q=2Q}F B.J.4L(2Q)},41:G(){u 1G=D.1G;u c=D.1B;if(H(1G)=="L"||1G===O){1G=B.V.bC(D.1B);D.1G=1G}F B.J.4L(1G)},1l:G(){F D.hl()},U:G(){u c=D.1B;u hk=[c.r,c.g,c.b,c.a];F D.bX.1r+"("+hk.2b(", ")+")"}};B.J.2l(B.V.V,{3Y:G(1v,bW,1F,8H){u hj=B.V.V;if(M.K==1){u 1B=1v;1v=1B.r;bW=1B.g;1F=1B.b;if(H(1B.a)=="L"){8H=L}N{8H=1B.a}}F Y hj(1v,bW,1F,8H)},4H:G(1o,t0,sZ,sY){u m=B.V;F m.V.3Y(m.bB.1w(m,M))},sX:G(1o,sW,sV,sU){u m=B.V;F m.V.3Y(m.bz.1w(m,M))},hi:G(1b){u 8F=B.V.V;if(1b.3Z(0)=="\\""){1b=1b.3H(1,1b.K-2)}u bV=8F.by[1b.8G()];if(H(bV)=="1n"){F 8F.bT(bV)}N{if(1b=="aP"){F 8F.sT()}}F O},8f:G(4Q){u I=B.V.V;u bU=4Q.3H(0,3);if(bU=="1B"){F I.h9(4Q)}N{if(bU=="1G"){F I.h8(4Q)}N{if(4Q.3Z(0)=="#"){F I.bT(4Q)}}}F I.hi(4Q)},bT:G(4P){if(4P.3Z(0)=="#"){4P=4P.2W(1)}u 8E=[];u i,5x;if(4P.K==3){R(i=0;i<3;i++){5x=4P.3H(i,1);8E.1c(3w(5x+5x,16)/3h)}}N{R(i=0;i<6;i+=2){5x=4P.3H(i,2);8E.1c(3w(5x,16)/3h)}}u bS=B.V.V;F bS.3Y.1w(bS,8E)},bG:G(4O,hf,hg,4N){if(4N.2A(4O)===0){4N=4N.2W(4N.2A("(",3)+1,4N.K-1)}u bR=4N.2R(/\\s*,\\s*/);u bP=[];R(u i=0;i0){F 8D}}F O},ba:G(Q){u 2F=B.V.V;F 2F.bN(Q,"aZ","he-3U")||2F.sN()},sM:G(Q){u 2F=B.V.V;F 2F.bN(Q,"3U","3U")||2F.sL()},sK:G(){F B.J.4L(B.V.V.by)}});B.J.2l(B.V,{6F:G(v,8C){v*=8C;if(v<0){F 0}N{if(v>8C){F 8C}N{F v}}},hc:G(n1,n2,1o){if(1o>6){1o-=6}N{if(1o<0){1o+=6}}u 2i;if(1o<1){2i=n1+(n2-n1)*1o}N{if(1o<3){2i=n2}N{if(1o<4){2i=n1+(n2-n1)*(4-1o)}N{2i=n1}}}F 2i},bz:G(1o,5w,3i,bM){if(M.K==1){u 2Q=1o;1o=2Q.h;5w=2Q.s;3i=2Q.v;bM=2Q.a}u 1v;u 3K;u 1F;if(5w===0){1v=0;3K=0;1F=0}N{u i=28.8B(1o*6);u f=(1o*6)-i;u p=3i*(1-5w);u q=3i*(1-(5w*f));u t=3i*(1-(5w*(1-f)));hd(i){3j 1:1v=q;3K=3i;1F=p;2K;3j 2:1v=p;3K=3i;1F=t;2K;3j 3:1v=p;3K=q;1F=3i;2K;3j 4:1v=t;3K=p;1F=3i;2K;3j 5:1v=3i;3K=p;1F=q;2K;3j 6:3j 0:1v=3i;3K=t;1F=p;2K}}F{r:1v,g:3K,b:1F,a:bM}},bB:G(1o,5v,3v,bL){if(M.K==1){u 1G=1o;1o=1G.h;5v=1G.s;3v=1G.l;bL=1G.a}u 1v;u 8A;u 1F;if(5v===0){1v=3v;8A=3v;1F=3v}N{u m2;if(3v<=0.5){m2=3v*(1+5v)}N{m2=3v+5v-(3v*5v)}u m1=(2*3v)-m2;u f=B.V.hc;u h6=1o*6;1v=f(m1,m2,h6+2);8A=f(m1,m2,h6);1F=f(m1,m2,h6-2)}F{r:1v,g:8A,b:1F,a:bL}},bA:G(1v,4K,1F,bK){if(M.K==1){u 1B=1v;1v=1B.r;4K=1B.g;1F=1B.b;bK=1B.a}u 29=28.29(28.29(1v,4K),1F);u 2a=28.2a(28.2a(1v,4K),1F);u 1o;u 8z;u hb=29;if(2a==29){1o=0;8z=0}N{u 6H=(29-2a);8z=6H/29;if(1v==29){1o=(4K-1F)/6H}N{if(4K==29){1o=2+((1F-1v)/6H)}N{1o=4+((1v-4K)/6H)}}1o/=6;if(1o<0){1o+=1}if(1o>1){1o-=1}}F{h:1o,s:8z,v:hb,a:bK}},bC:G(1v,4J,1F,bI){if(M.K==1){u 1B=1v;1v=1B.r;4J=1B.g;1F=1B.b;bI=1B.a}u 29=28.29(1v,28.29(4J,1F));u 2a=28.2a(1v,28.2a(4J,1F));u 1o;u 6G;u bJ=(29+2a)/2;u 4I=29-2a;if(4I===0){1o=0;6G=0}N{if(bJ<=0.5){6G=4I/(29+2a)}N{6G=4I/(2-29-2a)}if(1v==29){1o=(4J-1F)/4I}N{if(4J==29){1o=2+((1F-1v)/4I)}N{1o=4+((1v-4J)/4I)}}1o/=6;if(1o<0){1o+=1}if(1o>1){1o-=1}}F{h:1o,s:6G,l:bJ,a:bI}},6E:G(1P){1P=28.ha(1P);u bH=1P.1l(16);if(1P<16){F"0"+bH}F bH},2d:G(){u m=B.J;D.V.h9=m.1O(D.V.bG,D.V,"1B","3Y",[1/3h,1/3h,1/3h,1]);D.V.h8=m.1O(D.V.bG,D.V,"1G","4H",[1/bF,0.bE,0.bE,1]);u 4G=1/3;u bD={8y:[0,0,0],1F:[0,0,1],gY:[0.6,0.4,0.2],gX:[0,1,1],sJ:[4G,4G,4G],gR:[0.5,0.5,0.5],bx:[0,1,0],sI:[2*4G,2*4G,2*4G],gN:[1,0,1],gL:[1,0.5,0],gK:[0.5,0,0.5],1v:[1,0,0],aP:[0,0,0,0],4F:[1,1,1],gI:[1,1,0]};u h7=G(1b,r,g,b,a){u W=D.3Y(r,g,b,a);D[1b]=G(){F W};F W};R(u k in bD){u 1b=k+"V";u h5=m.2o([h7,D.V,1b],bD[k]);D.V[1b]=m.1O.1w(O,h5)}u h0=G(){R(u i=0;i1){u 1d=B.S.1E(M[0]);u 2D=M[1];u 1i=M[2];u 1A=M[3];R(u i=5o.K-1;i>=0;i--){u o=5o[i];if(o[0]===1d&&o[1]===2D&&o[4]===1i&&o[5]===1A){I.6t(o);5o.4y(i,1);F 1h}}}N{u 5n=m.bi(5o,bh);if(5n>=0){I.6t(bh);5o.4y(5n,1);F 1h}}F 1m},8i:G(1d,2D){1d=B.S.1E(1d);u m=B.J;u 8l=m.bg(m.1R(O,M,1));u I=B.1u;u bd=I.6t;u 4z=I.4x;if(8l.K===0){R(u i=4z.K-1;i>=0;i--){u 4A=4z[i];if(4A[0]===1d){bd(4A);4z.4y(i,1)}}}N{u bf={};R(u i=0;i<8l.K;i++){bf[8l[i]]=1h}R(u i=4z.K-1;i>=0;i--){u 4A=4z[i];if(4A[0]===1d&&4A[1]in bf){bd(4A);4z.4y(i,1)}}}},8h:G(1d,2D){u bc=B.1u.4x;1d=B.S.1E(1d);u 3G=B.J.1R(O,M,2);u 5m=[];R(u i=0;i1){u e=Y 2x("mZ bb mY in mX \'2D\', mW bb mV");e.bb=5m;14 e}}}});B.1u.1W=[];B.1u.1z=["6s","8j","8h","8i"];B.1u.2d=G(2m){u m=B.J;D.1Z=2v;D.3X=2m;1f{D.6s(2O,"g8",D.g7)}1e(e){}D.2k={":3e":D.1z,":1p":m.2o(D.1z,D.1W)};m.3f(D)};B.1u.2d(D);if(!B.3d){6s=B.1u.6s;8j=B.1u.8j;8i=B.1u.8i;8h=B.1u.8h}B.J.2Y(D,B.1u);if(H(1q)!="L"){1q.2X("B.1X");1q.2M("B.J");1q.2M("B.S");1q.2M("B.V")}if(H(1x)!="L"){1x.26("B.J",[]);1x.26("B.S",[]);1x.26("B.V",[])}1f{if(H(B.J)=="L"||H(B.S)=="L"||H(B.V)=="L"){14""}}1e(e){14"B.1X 3F on B.J, B.S 3W B.V!"}if(H(B.1X)=="L"){B.1X={}}B.1X.1r="B.1X";B.1X.1Y="1.3.1";B.1X.1K=G(){F"["+D.1r+" "+D.1Y+"]"};B.1X.1l=G(){F D.1K()};B.1X.aI=G(e,g6){e=B.S.1E(e);D.fN(g6);if(D.1S.fL){e=D.g5(e)}u 4w=D.1S.3U;u C=B.V.V;if(D.1S.3U=="aW"){4w=C.ba(e)}N{if(!(4w 2C C)){4w=C.8f(4w)}}D.82=(4w.6r().a<=0);u 5l=D.1S.aV;if(D.1S.aV=="fM"){5l=C.ba(e.8g)}N{if(!(5l 2C C)){5l=C.8f(5l)}}D.g3(e,4w,5l)};B.1X.aI.1U={g5:G(e){u mU=e.3t;u 1N=B.S.b9();if(H(1N.5k)=="L"||1N.5k===O){F e}u 4v=1N.5k.g4(e,O);if(H(4v)=="L"||4v===O){F e}u b8=B.S.6m({"1T":{3u:"8c",mT:4v.6q("6p-3D"),85:4v.6q("6p-3g"),mS:4v.6q("6p-6f"),86:4v.6q("6p-2I"),6p:"2N"}});b8.6o=e.6o;e.6o="";e.2c(b8);F e},g3:G(e,b7,8e){if(D.1S.3E){D.g2(e,8e)}if(D.fy()){D.fX(e,b7,8e)}if(D.fx()){D.fV(e,b7,8e)}},g2:G(el,g1){u b6="6l 8a "+D.aQ(g1);u g0="3E-2I: "+b6;u fZ="3E-3g: "+b6;u fY="1T=\'"+g0+";"+fZ+"\'";el.6o="<4u "+fY+">"+el.6o+""},fX:G(el,fW,b5){u b4=D.b1(b5);R(u i=0;i=0;i--){b2.2c(D.b0(fU,b3,i,"6f"))}el.1T.mP=0;el.2c(b2)},b1:G(fT){u 2q=B.S;F 2q.6m({1T:{aZ:fT.1l()}})},b0:G(aY,fQ,n,aX){u 6k=B.S.8d();u 2p=6k.1T;2p.aZ=aY.1l();2p.3u="8c";2p.3V="6l";2p.fS="fR";2p.mO="6l";u 8b=D.aQ(aY,fQ);if(D.1S.3E&&n===0){2p.mN="8a";2p.mM="6l";2p.84="2N";2p.83="2N";2p.mL="2N";2p.3V="2N";2p.fP=8b.1l()}N{if(8b){2p.fP=8b.1l();2p.mK="8a";2p.mJ="2N 6l"}}if(!D.1S.4r&&(n==(D.1S.89-1))){2p.3V="fO"}D.fI(6k,n,aX);D.fG(6k,n,aX);F 6k},fN:G(fK){D.1S={6g:"1p",3U:"aW",aV:"fM",5j:1h,3E:1m,4r:1m,fL:1m};B.J.2l(D.1S,fK);D.1S.89=(D.1S.4r?2:4)},aL:G(){u 88=D.1S.6g;if(D.6h(88,"1p","3D")){F""}u aU=(88.2A("tl")!=-1);u aT=(88.2A("tr")!=-1);if(aU&&aT){F""}if(aU){F"2I"}if(aT){F"3g"}F""},aK:G(){u 87=D.1S.6g;if(D.6h(87,"1p","6f")){F""}u aS=(87.2A("bl")!=-1);u aR=(87.2A("br")!=-1);if(aS&&aR){F""}if(aS){F"2I"}if(aR){F"3g"}F""},aQ:G(aN,aO){if(aN=="aP"){F aO}N{if(D.1S.3E){F D.1S.3E}N{if(D.1S.5j){F aO.fJ(aN)}}}F""},fI:G(el,n,fH){u 6j=D.fE(n)+"px";u aM=(fH=="3D"?D.aL():D.aK());u 4t=el.1T;if(aM=="2I"){4t.86=6j;4t.85="2N"}N{if(aM=="3g"){4t.85=6j;4t.86="2N"}N{4t.86=6j;4t.85=6j}}},fG:G(el,n,fF){u 6i=D.fz(n)+"px";u aJ=(fF=="3D"?D.aL():D.aK());u 4s=el.1T;if(aJ=="2I"){4s.84=6i;4s.83="2N"}N{if(aJ=="3g"){4s.83=6i;4s.84="2N"}N{4s.84=6i;4s.83=6i}}},fE:G(n){if(D.82){F 0}u o=D.1S;if(o.4r&&o.5j){u fD=[1,0];F fD[n]}N{if(o.4r){u fC=[2,1];F fC[n]}N{if(o.5j){u fB=[3,2,1,0];F fB[n]}N{u fA=[5,3,2,1];F fA[n]}}}},fz:G(n){u o=D.1S;u 5i;if(o.4r&&(o.5j||D.82)){F 1}N{if(o.4r){5i=[1,0]}N{if(o.5j){5i=[2,1,1,1]}N{if(o.3E){5i=[0,2,0,0]}N{if(D.82){5i=[5,3,2,1]}N{F 0}}}}}F 5i[n]},6h:G(1y){R(u i=1;i")}}})()}',62,1976,'||||||||||||||||||||||||||||||var|||||||MochiKit||this||return|function|typeof|self|Base|length|undefined|arguments|else|null||elem|for|DOM||repr|Color|rval|res|new||||||throw|Iter|||||next|name|push|src|catch|try|lst|true|obj|node|Async|toString|false|string|hue|all|dojo|NAME|Format|msg|Signal|red|apply|JSAN|str|EXPORT|func|rgb|_425|DateTime|getElement|blue|hsl|Logging|LoggingPane|type|__repr__|_event|while|doc|bind|num|iter|extend|options|style|prototype|seq|EXPORT_OK|Visual|VERSION|_document||_434||replace|forwardCall|StopIteration|use||Math|max|min|join|appendChild|__new__|button|compare|date|key|val|_329|EXPORT_TAGS|update|win|pair|concat|_596|dom|map|req|Deferred|sync|document|base|Error|number|partial|indexOf||instanceof|sig|not|cls|list|fired|left|stop|break|logger|require|0px|window|shift|hsv|split|createElement|_423|callee|continue|substring|provide|_exportSymbols|ccc||_464|||||||||step|pred|_51|__compat__|common|nameFunctions|right|255|_517|case|100|_loggingPane|value|object|callback|TypeError|_251|_246|_113|parentNode|display|_522|parseInt|cssText|wrap|info|isArrayLike|end|match|top|border|depends|args|substr|mouse|code|_519|_443|className|level|err|frac|Date|_135|_85|nodeType|color|height|and|_window|fromRGB|charAt||asHSL|_444|message||||filter||LogMessage|AdapterRegistry|_366|imap|NotFound|locked|counter|_262|_messages|operator|cmp|_165|_161|pairs|arr|_52|setAttribute|computedStyle|compact|_614|_610|div|_576|_572|_observers|splice|_565|_566|_555|scrollTop|page|modifier|white|_541|fromHSL|_539|_535|_528|clone|parseFloat|_505|pre|_499|_497|_427|createTextNode|_446|attributeArray|_388|_379|updateNodeAttributes|_341|_326||box|errback|results|paused|chain|_285||ofs||NamedError|_175|_147|_122|_83|_54|_17|childNodes|_619|blend|defaultView|_574|_569|idx|_562|must|_554|_specialKeys|body|Coordinates|registerComparator|_521|_516|hex|mid|_478|width|loggingPane|LogLevel|nwin|head|url|setElementClass|callStack|path|dest|_359|boolean|register|Dimensions|DeferredLock|_313|addCallback|_310|waiting|onreadystatechange|_290|LOCALE|year|printfire|_214|log|_213|_211|pos|_155|_153||typeMatcher|listMinMax|_114|_40|itr|typ|_19|_634|_625|bottom|corners|_hasString|_612|_608|_595|1px|DIV|firstChild|innerHTML|padding|getPropertyValue|asRGB|connect|_disconnect|_559|middle|which|clientY|scrollLeft|clientX|client|charCode|relatedTarget|event|toColorPart|clampColorComponent|_537|_534|toFixed|_468|buildAndApplyFilter|_442|_441|_440|_439|position|_463|_447|removeChild|_449|uid|_428|_426|compliant|attributes|_422|_409|_412|_400|_395|_390|_389|_377|_375|_363|attr|ctx|repeat|_340|_339|isNotEmpty|_335|_333|opera|DeferredList|ret|_309|silentlyCancelled|canceller|_nextId|Array|_293|XMLHttpRequest|chained|_281|tail|_252|_225|msec|day|month|iso|Logger|_208|listeners|_200|_198|_194|_196|reduce|range|_169|_162|truth|registerRepr|_121|_70|_58|_56|_47|_45|_41|_13|_1|script|text|uri|documentElement|_630|_629|isTransparent|borderRightWidth|borderLeftWidth|marginRight|marginLeft|_602|_599|numSlices|solid|_597|block|SPAN|_579|fromString|offsetParent|signal|disconnectAll|disconnect|_570|_563|_557|preventDefault|stopPropagation|clientTop|clientLeft|pageY|pageX|keyCode|meta|ctrl|alt|target|black|_532|_524|floor|_513|_512|_500|_495|toLowerCase|_487|DEBUG|INFO|WARNING|FATAL|ERROR|colorTable|logFont|closed|inline|onclick|_438|_437|_445|RegExp|_452|space|title|updatetree|||||withDocument|withWindow||setDisplayForElement|none|renames|forEach|domConverters|escapeHTML|addElementClass|removeElementClass|once|_378|_380|_376|appendChildNodes|coerceToDOM|_355|opt|clientWidth|opacity|GenericError|fail|resultList|_307|_301|_fire|can|addCallbacks|_resback|percent|decimal|separator|twoDigitFloat|_274|_273|_264|_257|_250|_249|_254|_248|_243|_242|fmt|_240|_245|getTime|sec|hour|_209|slice|_206|iterateNextIter|registerIteratorFactory|arrayLikeIter|iteratorRegistry|takewhile|ifilterfalse|ifilter|_181|_176|_168|_166|_159|_tee|deque|arg|fun|jsonRegistry|reprString|reprRegistry|comparatorRegistry|urlEncode|_110|_108|cur|_95|_87|_71|im_preargs||_53|_57|_46|present|like|array|Argument|_15|_12|_632|_631|_633|SUBMODULES|only|_628|_627|_626|roundElement|_624|getElementsByTagAndClassName|_RoundCorners|_613|_whichSideBottom|_whichSideTop|_609|_605|_606|transparent|_borderColor|_604|_603|_601|_600|bgColor|fromElement|_594|_592|backgroundColor|_createCornerSlice|_createCorner|_590|_589|_587|_586|_581|_578|_577|currentDocument|fromBackground|errors|_568|_564||sigs|flattenArguments|_561|findIdentical|_560|_558||_556|attachEvent|addEventListener|funcOrStr|Event||_548|fromCharCode|String|_specialMacKeys|any|green|_namedColors|hsvToRGB|rgbToHSV|hslToRGB|rgbToHSL|_542|01|360|_fromColorString|_540|_536|_538|_529|_523|_518|fromComputedStyle|_511|_507|_508|_506|_501|fromHexString|_498|_496|_486|__class__|createLoggingPane|_459|_461|font|_462|_430|_435|1000|index|_460|getMessages|removeListener|_451||_457|_450|infore|_448|_456|logDebug|offsetHeight|span|input|_436|TR||HTML|open|alert|currentWindow|swapDOM|SELECT|FORM|INPUT|createDOMFunc|ignoreAttr|_421|call|_417|_410|_415|nodeName|_414|_413|emitHTML|good|_406|_399|_397|_393|_392|addLoadEvent|addToCallStack|_387|_386|_381|_382|_383|_373|_372|_369|createDOM|_365|Function|_360|_362|_358|_344|nodeWalk|formContents|_337|_338|_334|_332|offsetTop|offsetLeft|visibility|parentElement|||XMLHttpRequestError|BrowserComplianceError|CancelledError|AlreadyCalledError|evalJSONRequest|sendXMLHttpRequest|wait|doSimpleXMLHttpRequest|getXMLHttpRequest|succeed|_312|finishedCount|_308|_cbDeferred|_303|_297|queryString|_nothing|_289|XMLHTTP|ActiveXObject|eval|_284|_check|error|_279|default|rstrip|lstrip|formatLocale|roundToFixed|truncToFixed|_276|pow|_272|_271|_270|sign|_265|_263|tmp|_238|_232|toISODate|toISOTime|getFullYear|getDate|getMonth|_230|_padTwo|_228|useNativeConsole|_212|compareLogMessage|isLogMessage|unshift|_207||maxSize|_202|_199|logLevelAtLeast|console|hasIterateNext|iterateNext|arrayLike|groupby||exhaust|tee|dropwhile|applymap||islice|izip|cycle|count||_189|_188|_183|_185|_184|_186|_187|_182|identity|fetch|_180|_177|listMin|reprNumber|reprArrayLike|compareArrayLike|compareDateLike|isDateLike|findValue|_128|__export__|keyComparator|_124|_118|_93|_94|_90|_88|_84|_77|_68|_67|_66|_65|_60|im_func|_55|im_self|_48|_44|_42|_39|_36|_33|_27|_26|_25|_22|_24|_20|javascript|write|getAttribute||org|www|http|getElementsByTagName|roundClass|_623|_622|_621|_620|_isBottomRounded|_isTopRounded|_borderSize|_618|_617|_616|_615|_marginSize|_611|_setBorder|_607|_setMargin|blendedColor|_598|__unstable__wrapElement|fromParent|_setOptions|2px|borderColor|_593|hidden|overflow|_591|_588|_roundBottomCorners|_585|_roundTopCorners|_584|_583|_582|_580|_renderBorder|_roundCornersImpl|getComputedStyle|_doWrap|_571|_unloadCache|onunload|detachEvent|removeEventListener|_listener|objOrFunc|_552||_551|_549|onload|delete|112|KEY_F|KEY_|MINUS|KEY_SEMICOLON|KEY_DELETE|KEY_INSERT|KEY_ARROW_DOWN|KEY_ARROW_RIGHT|KEY_ARROW_UP||KEY_ARROW_LEFT|KEY_HOME|KEY_END|KEY_PAGE_DOWN|KEY_PAGE_UP|KEY_ENTER|KEY_NUM_PAD_CLEAR|63236|mousemove|contextmenu|click|mouseout|mouseover|_src|yellow|708090|purple|orange|ff00ff|magenta|778899|d3d3d3|808080|gray|696969|2f4f4f|darkred|a9a9a9|00ffff|cyan|brown|_547|_546||||compareRGB|_545||_543|fromHSLString|fromRGBString|round|_533|_hslValue|switch|background|_503|_504||fromName|_488|col|toRGBString|_hexString|_rgbString|_hslString|toPrecision|isLight||_481|_477|_476|_475|_474|_473|_469|_466|closePane|_458|onkeypress|_454|addListener|_455|close|test|scrollHeight|option|word|moz|_431|getElementById|html|pop|200|_|removeElement|showElement|hideElement|CANVAS|STRONG|FIELDSET|LEGEND|OPTGROUP|OPTION|TEXTAREA|LABEL|HR|BR|H3|H2|H1|PRE|TT|BUTTON|IMG|TH||TABLE||TFOOT|THEAD|TBODY|TD|LI|OL|||UL|checked|class|ignoreAttrFilter||_424|_419|nodeValue|scrapeText|_416|_418|sort|_411|toHTML|_404|hasElementClass|_403|_402|_401|swapElementClass|_398|_394|toggleElementClass|_391|focusOnLoad|_newCallStack|currentStyle|_371|replaceChildNodes|_364|_361|getNodeAttribute|_357|setNodeAttribute|_354|_352|_350|_353|toDOM|_346|_345|registerDOMConverter|selectedIndex|setElementPosition|setElementDimensions|tagName|absolute|getBoxObjectFor|getBoundingClientRect|elementPosition|_325|_324|_322|_323|offsetWidth|elementDimensions|clientHeight|innerWidth|getViewportDimensions|setOpacity|status|_317|deferred|_316|_newNamedError|maybeDeferred||gatherResults|callLater|loadJSONDoc|_311|consumeErrors|fireOnOneErrback|fireOnOneCallback|addErrback|_305|_304|_306|unlocked|release|_300|_299|_298|_296|_xhr_onreadystatechange|_xhr_canceller|304|responseText|Msxml2|addBoth|_pause|_continue|result|the|are|they|instances|_unpause|cancel|_280|_278|en_US|strip|percentFormat|twoDigitAverage|numberFormatter|_277|_275|isNaN|_259|_258|_260|_255|_253|_numberFormatter|_241|_239|_237|_236|_235|_234|_233|_231|toAmericanDate|toPaddedAmericanDate|americanDate|toISOTimestamp|isoTimestamp|isoDate|foot|sep||60000|_221|_isoRegexp|dispatchEvent|createEvent|warning|logWarning|fatal|logFatal|debug|logError|baseLog|_210|getMessageText|logToConsole|dispatchListeners|_204|_203|ident|_201|postError|alertListener|_197|_192|groupby_as_array|iextend|some|reversed|sorted|every|sum|_190|eat|_174|_173|_172|_171|_167|_163|_158|_157|_151|_144|_141||_139|_136|_134||_133|_132|zip|merge|isUndefined|isCallable|listMax|_131|_130|encodeURIComponent||_127|method|parseQueryString|evalJSON|registerJSON|serializeJSON|objMin|objMax|reverseKeyComparator|arrayEqual|objEqual|bindMethods|xfilter|xmap|isEmpty|isNull|isUndefinedOrNull|itemgetter|items|keys|setdefault|_126|_120|decodeURIComponent|_119|len|_109|_107|_104|_105|_101|_102|_98|||_100|_97|_96|_91|json|__json__|_82|_81|_80|_79|_76||_75|_74|_73|_69|_primitives|_64|_63||_62|_61|_59|_wrapDumbFunction|_49|_50|_31|_30|_21|_7|application|MochiKit_|createElementNS|namespaceURI|lastIndexOf|xul|there|gatekeeper|keymaster|mozilla|getElementsComputedStyle|_hasSingleTextChild|borderWidth|borderStyle|borderBottomWidth|borderTopWidth|borderTopStyle|fontSize|paddingBottom|insertBefore|paddingTop|marginBottom|marginTop|_575|property|see|handling|thrown|Multiple|element|||given|123|KEY_NUM_PAD_|105|KEY_APOSTROPHE|222|KEY_RIGHT_SQUARE_BRACKET|221|KEY_REVERSE_SOLIDUS|220|KEY_LEFT_SQUARE_BRACKET||219|KEY_GRAVE_ACCENT|192|KEY_SOLIDUS|191|KEY_FULL_STOP|190|KEY_HYPHEN|189||KEY_COMMA|188|KEY_EQUALS_SIGN|187|186|KEY_SCROLL_LOCK|145|KEY_NUM_LOCK|144|KEY_NUM_PAD_SOLIDUS|111|KEY_NUM_PAD_FULL_STOP|110|KEY_NUM_PAD_HYPHEN|109|KEY_NUM_PAD_PLUS_SIGN|107|KEY_NUM_PAD_ASTERISK|106|KEY_SELECT|KEY_WINDOWS_RIGHT|KEY_WINDOWS_LEFT|KEY_PRINT_SCREEN|KEY_SPACEBAR|KEY_ESCAPE|KEY_CAPS_LOCK|KEY_PAUSE|KEY_ALT|KEY_CTRL|KEY_SHIFT|KEY_TAB|KEY_BACKSPACE|63242|63272|63302|63233|63235|63232|63234|63273|63275|63277|63276|63289|returnValue|cancelBubble|keypress|KEY_UNKNOWN|keyup|keydown|shiftKey|metaKey||ctrlKey|altKey|toElement|srcElement|9acd32||yellowgreen||ffff00|f5f5f5|whitesmoke||ffffff|f5deb3|wheat|ee82ee|violet|40e0d0|turquoise|ff6347|tomato|d8bfd8|thistle|008080|teal|d2b48c|tan|4682b4|steelblue|00ff7f|springgreen|fffafa|snow|slategrey|slategray|6a5acd|slateblue|87ceeb|skyblue|c0c0c0|silver|a0522d|sienna|fff5ee|seashell|2e8b57|seagreen|f4a460|sandybrown|fa8072|salmon|8b4513|saddlebrown|4169e1|royalblue|bc8f8f|rosybrown|ff0000|800080|b0e0e6|powderblue|dda0dd|plum|ffc0cb|pink|cd853f||peru|ffdab9|peachpuff|ffefd5|papayawhip|db7093|palevioletred|afeeee|paleturquoise|98fb98|palegreen|eee8aa||palegoldenrod|da70d6|orchid|ff4500|orangered|ffa500|6b8e23|olivedrab|808000|olive|fdf5e6|oldlace|000080|navy|ffdead|navajowhite|ffe4b5|moccasin|ffe4e1|mistyrose|f5fffa|mintcream|191970|midnightblue|c71585|mediumvioletred|48d1cc|mediumturquoise|00fa9a|mediumspringgreen|7b68ee|mediumslateblue|3cb371|mediumseagreen|9370db|mediumpurple|ba55d3|mediumorchid|0000cd|mediumblue|66cdaa|mediumaquamarine|800000|maroon|faf0e6|linen|32cd32|limegreen|00ff00|lime|ffffe0|lightyellow|b0c4de|lightsteelblue|lightslategrey|lightslategray||87cefa|lightskyblue|20b2aa|lightseagreen|ffa07a|lightsalmon|ffb6c1|lightpink|lightgrey|90ee90|lightgreen|lightgray|fafad2|lightgoldenrodyellow|e0ffff|lightcyan|f08080|lightcoral|add8e6|lightblue|fffacd|lemonchiffon|7cfc00|lawngreen|fff0f5|lavenderblush|e6e6fa|lavender|f0e68c|khaki|fffff0|ivory|4b0082|indigo|cd5c5c|indianred|ff69b4|hotpink|f0fff0|honeydew|grey|adff2f|greenyellow|008000|daa520|goldenrod|ffd700||gold|f8f8ff|ghostwhite|dcdcdc|gainsboro|fuchsia|228b22|forestgreen|fffaf0|floralwhite|b22222|firebrick|1e90ff|dodgerblue|dimgrey|dimgray|00bfff|deepskyblue|ff1493|deeppink|9400d3|darkviolet|00ced1|darkturquoise|darkslategrey|darkslategray|483d8b|darkslateblue|8fbc8f|darkseagreen|e9967a|darksalmon|8b0000|9932cc|darkorchid|ff8c00|darkorange|556b2f|darkolivegreen|8b008b|darkmagenta|bdb76b|darkkhaki|darkgrey|006400|darkgreen|darkgray|b8860b|darkgoldenrod|008b8b|darkcyan|00008b|darkblue|dc143c|crimson|fff8dc|cornsilk|6495ed|cornflowerblue|ff7f50|coral|d2691e||chocolate|7fff00|chartreuse|5f9ea0|cadetblue|deb887|burlywood|a52a2a|8a2be2|blueviolet|0000ff|ffebcd||blanchedalmond|000000|ffe4c4|bisque|f5f5dc|beige|f0ffff|azure|7fffd4|aquamarine|aqua|faebd7|antiquewhite|f0f8ff|aliceblue|lightGray|darkGray|namedColors|blackColor|fromText|whiteColor|_510|_509|PI|rad|deg|transparentColor|_494|_493|_492|fromHSV|_491|_490|_489|asHSV|toHexString|rgba|hsla|toHSLString|isDark|lighterColorWithLevel|darkerColorWithLevel|colorWithLightness|colorWithSaturation|colorWithHue|colorWithAlpha||serif|sans|Verdana||8pt|8em|auto||Close|Clear||Load|Filter||10em||fixed|regex|emergency|line|margin|_Listener|dtd|loose|html4|w3|EN|Transitional|DTD|W3C|PUBLIC|DOCTYPE|blocking|due|debugging|able|Not|resizable|dependent|href|location|_MochiKit_LoggingPane|_429|canvas|strong|fieldset|legend|optgroup|select|form|textarea|label|img|table|tfoot|thead|tbody|htmlFor||useMap|usemap|defaultChecked|hasChildNodes|quot|amp|_405|focus|replaceChild|checkbox||radio|_win|BODY||safari|version|userAgent|navigator|innerHeight|alpha|khtml|Tried|acquire|clearTimeout|setTimeout|GET|ignore|send|abort|failed|Request|readyState|support|does|Browser|Microsoft|_288|_287|used|Deferreds|Chained|success|unfired|fr_FR|de_DE|00|abs|search|pattern|Invalid|getTimezoneOffset|getSeconds|getMinutes|getHours|UTC|3600000|initEvent|Events|debuggingBookmarklet|MESSAGES|LAST|_205|clear|ninfo|nlevel|timestamp|reverse|takes|initial|with|sequence|empty|iterable|numbers|dateLike|escape|find|forward|unregister|unescape|Object|compared|item|contains|logor|logand|cle|clt|cge|cgt|cne|ceq|zrshift|rshift|lshift|xor|mul|mod|sub|add|neg|lognot|_9|_2'.split('|'),0,{}) + + +/* + * jQuery 1.2.1 - New Wave Javascript + * + * Copyright (c) 2007 John Resig (jquery.com) + * Dual licensed under the MIT (MIT-LICENSE.txt) + * and GPL (GPL-LICENSE.txt) licenses. + * + * $Date: 2007-09-16 23:42:06 -0400 (Sun, 16 Sep 2007) $ + * $Rev: 3353 $ + */ + +var decompressedJQuery = function(p,a,c,k,e,r){e=function(c){return(c35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('(G(){9(1m E!="W")H w=E;H E=18.15=G(a,b){I 6 7u E?6.5N(a,b):1u E(a,b)};9(1m $!="W")H D=$;18.$=E;H u=/^[^<]*(<(.|\\s)+>)[^>]*$|^#(\\w+)$/;E.1b=E.3A={5N:G(c,a){c=c||U;9(1m c=="1M"){H m=u.2S(c);9(m&&(m[1]||!a)){9(m[1])c=E.4D([m[1]],a);J{H b=U.3S(m[3]);9(b)9(b.22!=m[3])I E().1Y(c);J{6[0]=b;6.K=1;I 6}J c=[]}}J I 1u E(a).1Y(c)}J 9(E.1n(c))I 1u E(U)[E.1b.2d?"2d":"39"](c);I 6.6v(c.1c==1B&&c||(c.4c||c.K&&c!=18&&!c.1y&&c[0]!=W&&c[0].1y)&&E.2h(c)||[c])},4c:"1.2.1",7Y:G(){I 6.K},K:0,21:G(a){I a==W?E.2h(6):6[a]},2o:G(a){H b=E(a);b.4Y=6;I b},6v:G(a){6.K=0;1B.3A.1a.16(6,a);I 6},N:G(a,b){I E.N(6,a,b)},4I:G(a){H b=-1;6.N(G(i){9(6==a)b=i});I b},1x:G(f,d,e){H c=f;9(f.1c==3X)9(d==W)I 6.K&&E[e||"1x"](6[0],f)||W;J{c={};c[f]=d}I 6.N(G(a){L(H b 1i c)E.1x(e?6.R:6,b,E.1e(6,c[b],e,a,b))})},17:G(b,a){I 6.1x(b,a,"3C")},2g:G(e){9(1m e!="5i"&&e!=S)I 6.4n().3g(U.6F(e));H t="";E.N(e||6,G(){E.N(6.3j,G(){9(6.1y!=8)t+=6.1y!=1?6.6x:E.1b.2g([6])})});I t},5m:G(b){9(6[0])E(b,6[0].3H).6u().3d(6[0]).1X(G(){H a=6;1W(a.1w)a=a.1w;I a}).3g(6);I 6},8m:G(a){I 6.N(G(){E(6).6q().5m(a)})},8d:G(a){I 6.N(G(){E(6).5m(a)})},3g:G(){I 6.3z(1q,Q,1,G(a){6.58(a)})},6j:G(){I 6.3z(1q,Q,-1,G(a){6.3d(a,6.1w)})},6g:G(){I 6.3z(1q,P,1,G(a){6.12.3d(a,6)})},50:G(){I 6.3z(1q,P,-1,G(a){6.12.3d(a,6.2q)})},2D:G(){I 6.4Y||E([])},1Y:G(t){H b=E.1X(6,G(a){I E.1Y(t,a)});I 6.2o(/[^+>] [^+>]/.14(t)||t.1g("..")>-1?E.4V(b):b)},6u:G(e){H f=6.1X(G(){I 6.67?E(6.67)[0]:6.4R(Q)});H d=f.1Y("*").4O().N(G(){9(6[F]!=W)6[F]=S});9(e===Q)6.1Y("*").4O().N(G(i){H c=E.M(6,"2P");L(H a 1i c)L(H b 1i c[a])E.1j.1f(d[i],a,c[a][b],c[a][b].M)});I f},1E:G(t){I 6.2o(E.1n(t)&&E.2W(6,G(b,a){I t.16(b,[a])})||E.3m(t,6))},5V:G(t){I 6.2o(t.1c==3X&&E.3m(t,6,Q)||E.2W(6,G(a){I(t.1c==1B||t.4c)?E.2A(a,t)<0:a!=t}))},1f:G(t){I 6.2o(E.1R(6.21(),t.1c==3X?E(t).21():t.K!=W&&(!t.11||E.11(t,"2Y"))?t:[t]))},3t:G(a){I a?E.3m(a,6).K>0:P},7c:G(a){I 6.3t("."+a)},3i:G(b){9(b==W){9(6.K){H c=6[0];9(E.11(c,"24")){H e=c.4Z,a=[],Y=c.Y,2G=c.O=="24-2G";9(e<0)I S;L(H i=2G?e:0,33=2G?e+1:Y.K;i<33;i++){H d=Y[i];9(d.26){H b=E.V.1h&&!d.9V["1Q"].9L?d.2g:d.1Q;9(2G)I b;a.1a(b)}}I a}J I 6[0].1Q.1p(/\\r/g,"")}}J I 6.N(G(){9(b.1c==1B&&/4k|5j/.14(6.O))6.2Q=(E.2A(6.1Q,b)>=0||E.2A(6.2H,b)>=0);J 9(E.11(6,"24")){H a=b.1c==1B?b:[b];E("9h",6).N(G(){6.26=(E.2A(6.1Q,a)>=0||E.2A(6.2g,a)>=0)});9(!a.K)6.4Z=-1}J 6.1Q=b})},4o:G(a){I a==W?(6.K?6[0].3O:S):6.4n().3g(a)},6H:G(a){I 6.50(a).28()},6E:G(i){I 6.2J(i,i+1)},2J:G(){I 6.2o(1B.3A.2J.16(6,1q))},1X:G(b){I 6.2o(E.1X(6,G(a,i){I b.2O(a,i,a)}))},4O:G(){I 6.1f(6.4Y)},3z:G(f,d,g,e){H c=6.K>1,a;I 6.N(G(){9(!a){a=E.4D(f,6.3H);9(g<0)a.8U()}H b=6;9(d&&E.11(6,"1I")&&E.11(a[0],"4m"))b=6.4l("1K")[0]||6.58(U.5B("1K"));E.N(a,G(){H a=c?6.4R(Q):6;9(!5A(0,a))e.2O(b,a)})})}};G 5A(i,b){H a=E.11(b,"1J");9(a){9(b.3k)E.3G({1d:b.3k,3e:P,1V:"1J"});J E.5f(b.2g||b.6s||b.3O||"");9(b.12)b.12.3b(b)}J 9(b.1y==1)E("1J",b).N(5A);I a}E.1k=E.1b.1k=G(){H c=1q[0]||{},a=1,2c=1q.K,5e=P;9(c.1c==8o){5e=c;c=1q[1]||{}}9(2c==1){c=6;a=0}H b;L(;a<2c;a++)9((b=1q[a])!=S)L(H i 1i b){9(c==b[i])6r;9(5e&&1m b[i]==\'5i\'&&c[i])E.1k(c[i],b[i]);J 9(b[i]!=W)c[i]=b[i]}I c};H F="15"+(1u 3D()).3B(),6p=0,5c={};E.1k({8a:G(a){18.$=D;9(a)18.15=w;I E},1n:G(a){I!!a&&1m a!="1M"&&!a.11&&a.1c!=1B&&/G/i.14(a+"")},4a:G(a){I a.2V&&!a.1G||a.37&&a.3H&&!a.3H.1G},5f:G(a){a=E.36(a);9(a){9(18.6l)18.6l(a);J 9(E.V.1N)18.56(a,0);J 3w.2O(18,a)}},11:G(b,a){I b.11&&b.11.27()==a.27()},1L:{},M:G(c,d,b){c=c==18?5c:c;H a=c[F];9(!a)a=c[F]=++6p;9(d&&!E.1L[a])E.1L[a]={};9(b!=W)E.1L[a][d]=b;I d?E.1L[a][d]:a},30:G(c,b){c=c==18?5c:c;H a=c[F];9(b){9(E.1L[a]){2E E.1L[a][b];b="";L(b 1i E.1L[a])1T;9(!b)E.30(c)}}J{2a{2E c[F]}29(e){9(c.53)c.53(F)}2E E.1L[a]}},N:G(a,b,c){9(c){9(a.K==W)L(H i 1i a)b.16(a[i],c);J L(H i=0,48=a.K;i<48;i++)9(b.16(a[i],c)===P)1T}J{9(a.K==W)L(H i 1i a)b.2O(a[i],i,a[i]);J L(H i=0,48=a.K,3i=a[0];i<48&&b.2O(3i,i,3i)!==P;3i=a[++i]){}}I a},1e:G(c,b,d,e,a){9(E.1n(b))b=b.2O(c,[e]);H f=/z-?4I|7T-?7Q|1r|69|7P-?1H/i;I b&&b.1c==4W&&d=="3C"&&!f.14(a)?b+"2T":b},1o:{1f:G(b,c){E.N((c||"").2l(/\\s+/),G(i,a){9(!E.1o.3K(b.1o,a))b.1o+=(b.1o?" ":"")+a})},28:G(b,c){b.1o=c!=W?E.2W(b.1o.2l(/\\s+/),G(a){I!E.1o.3K(c,a)}).66(" "):""},3K:G(t,c){I E.2A(c,(t.1o||t).3s().2l(/\\s+/))>-1}},2k:G(e,o,f){L(H i 1i o){e.R["3r"+i]=e.R[i];e.R[i]=o[i]}f.16(e,[]);L(H i 1i o)e.R[i]=e.R["3r"+i]},17:G(e,p){9(p=="1H"||p=="2N"){H b={},42,41,d=["7J","7I","7G","7F"];E.N(d,G(){b["7C"+6]=0;b["7B"+6+"5Z"]=0});E.2k(e,b,G(){9(E(e).3t(\':3R\')){42=e.7A;41=e.7w}J{e=E(e.4R(Q)).1Y(":4k").5W("2Q").2D().17({4C:"1P",2X:"4F",19:"2Z",7o:"0",1S:"0"}).5R(e.12)[0];H a=E.17(e.12,"2X")||"3V";9(a=="3V")e.12.R.2X="7g";42=e.7e;41=e.7b;9(a=="3V")e.12.R.2X="3V";e.12.3b(e)}});I p=="1H"?42:41}I E.3C(e,p)},3C:G(h,j,i){H g,2w=[],2k=[];G 3n(a){9(!E.V.1N)I P;H b=U.3o.3Z(a,S);I!b||b.4y("3n")==""}9(j=="1r"&&E.V.1h){g=E.1x(h.R,"1r");I g==""?"1":g}9(j.1t(/4u/i))j=y;9(!i&&h.R[j])g=h.R[j];J 9(U.3o&&U.3o.3Z){9(j.1t(/4u/i))j="4u";j=j.1p(/([A-Z])/g,"-$1").2p();H d=U.3o.3Z(h,S);9(d&&!3n(h))g=d.4y(j);J{L(H a=h;a&&3n(a);a=a.12)2w.4w(a);L(a=0;a<2w.K;a++)9(3n(2w[a])){2k[a]=2w[a].R.19;2w[a].R.19="2Z"}g=j=="19"&&2k[2w.K-1]!=S?"2s":U.3o.3Z(h,S).4y(j)||"";L(a=0;a<2k.K;a++)9(2k[a]!=S)2w[a].R.19=2k[a]}9(j=="1r"&&g=="")g="1"}J 9(h.3Q){H f=j.1p(/\\-(\\w)/g,G(m,c){I c.27()});g=h.3Q[j]||h.3Q[f];9(!/^\\d+(2T)?$/i.14(g)&&/^\\d/.14(g)){H k=h.R.1S;H e=h.4v.1S;h.4v.1S=h.3Q.1S;h.R.1S=g||0;g=h.R.71+"2T";h.R.1S=k;h.4v.1S=e}}I g},4D:G(a,e){H r=[];e=e||U;E.N(a,G(i,d){9(!d)I;9(d.1c==4W)d=d.3s();9(1m d=="1M"){d=d.1p(/(<(\\w+)[^>]*?)\\/>/g,G(m,a,b){I b.1t(/^(70|6Z|6Y|9Q|4t|9N|9K|3a|9G|9E)$/i)?m:a+">"});H s=E.36(d).2p(),1s=e.5B("1s"),2x=[];H c=!s.1g("<9y")&&[1,"<24>",""]||!s.1g("<9w")&&[1,"<6T>",""]||s.1t(/^<(9u|1K|9t|9r|9p)/)&&[1,"<1I>",""]||!s.1g("<4m")&&[2,"<1I><1K>",""]||(!s.1g("<9m")||!s.1g("<9k"))&&[3,"<1I><1K><4m>",""]||!s.1g("<6Y")&&[2,"<1I><1K><6L>",""]||E.V.1h&&[1,"1s<1s>",""]||[0,"",""];1s.3O=c[1]+d+c[2];1W(c[0]--)1s=1s.5p;9(E.V.1h){9(!s.1g("<1I")&&s.1g("<1K")<0)2x=1s.1w&&1s.1w.3j;J 9(c[1]=="<1I>"&&s.1g("<1K")<0)2x=1s.3j;L(H n=2x.K-1;n>=0;--n)9(E.11(2x[n],"1K")&&!2x[n].3j.K)2x[n].12.3b(2x[n]);9(/^\\s/.14(d))1s.3d(e.6F(d.1t(/^\\s*/)[0]),1s.1w)}d=E.2h(1s.3j)}9(0===d.K&&(!E.11(d,"2Y")&&!E.11(d,"24")))I;9(d[0]==W||E.11(d,"2Y")||d.Y)r.1a(d);J r=E.1R(r,d)});I r},1x:G(c,d,a){H e=E.4a(c)?{}:E.5o;9(d=="26"&&E.V.1N)c.12.4Z;9(e[d]){9(a!=W)c[e[d]]=a;I c[e[d]]}J 9(E.V.1h&&d=="R")I E.1x(c.R,"9e",a);J 9(a==W&&E.V.1h&&E.11(c,"2Y")&&(d=="9d"||d=="9a"))I c.97(d).6x;J 9(c.37){9(a!=W){9(d=="O"&&E.11(c,"4t")&&c.12)6G"O 94 93\'t 92 91";c.90(d,a)}9(E.V.1h&&/6C|3k/.14(d)&&!E.4a(c))I c.4p(d,2);I c.4p(d)}J{9(d=="1r"&&E.V.1h){9(a!=W){c.69=1;c.1E=(c.1E||"").1p(/6O\\([^)]*\\)/,"")+(3I(a).3s()=="8S"?"":"6O(1r="+a*6A+")")}I c.1E?(3I(c.1E.1t(/1r=([^)]*)/)[1])/6A).3s():""}d=d.1p(/-([a-z])/8Q,G(z,b){I b.27()});9(a!=W)c[d]=a;I c[d]}},36:G(t){I(t||"").1p(/^\\s+|\\s+$/g,"")},2h:G(a){H r=[];9(1m a!="8P")L(H i=0,2c=a.K;i<2c;i++)r.1a(a[i]);J r=a.2J(0);I r},2A:G(b,a){L(H i=0,2c=a.K;i<2c;i++)9(a[i]==b)I i;I-1},1R:G(a,b){9(E.V.1h){L(H i=0;b[i];i++)9(b[i].1y!=8)a.1a(b[i])}J L(H i=0;b[i];i++)a.1a(b[i]);I a},4V:G(b){H r=[],2f={};2a{L(H i=0,6y=b.K;i<6y;i++){H a=E.M(b[i]);9(!2f[a]){2f[a]=Q;r.1a(b[i])}}}29(e){r=b}I r},2W:G(b,a,c){9(1m a=="1M")a=3w("P||G(a,i){I "+a+"}");H d=[];L(H i=0,4g=b.K;i<4g;i++)9(!c&&a(b[i],i)||c&&!a(b[i],i))d.1a(b[i]);I d},1X:G(c,b){9(1m b=="1M")b=3w("P||G(a){I "+b+"}");H d=[];L(H i=0,4g=c.K;i<4g;i++){H a=b(c[i],i);9(a!==S&&a!=W){9(a.1c!=1B)a=[a];d=d.8M(a)}}I d}});H v=8K.8I.2p();E.V={4s:(v.1t(/.+(?:8F|8E|8C|8B)[\\/: ]([\\d.]+)/)||[])[1],1N:/6w/.14(v),34:/34/.14(v),1h:/1h/.14(v)&&!/34/.14(v),35:/35/.14(v)&&!/(8z|6w)/.14(v)};H y=E.V.1h?"4h":"5h";E.1k({5g:!E.V.1h||U.8y=="8x",4h:E.V.1h?"4h":"5h",5o:{"L":"8w","8v":"1o","4u":y,5h:y,4h:y,3O:"3O",1o:"1o",1Q:"1Q",3c:"3c",2Q:"2Q",8u:"8t",26:"26",8s:"8r"}});E.N({1D:"a.12",8q:"15.4e(a,\'12\')",8p:"15.2I(a,2,\'2q\')",8n:"15.2I(a,2,\'4d\')",8l:"15.4e(a,\'2q\')",8k:"15.4e(a,\'4d\')",8j:"15.5d(a.12.1w,a)",8i:"15.5d(a.1w)",6q:"15.11(a,\'8h\')?a.8f||a.8e.U:15.2h(a.3j)"},G(i,n){E.1b[i]=G(a){H b=E.1X(6,n);9(a&&1m a=="1M")b=E.3m(a,b);I 6.2o(E.4V(b))}});E.N({5R:"3g",8c:"6j",3d:"6g",8b:"50",89:"6H"},G(i,n){E.1b[i]=G(){H a=1q;I 6.N(G(){L(H j=0,2c=a.K;j<2c;j++)E(a[j])[n](6)})}});E.N({5W:G(a){E.1x(6,a,"");6.53(a)},88:G(c){E.1o.1f(6,c)},87:G(c){E.1o.28(6,c)},86:G(c){E.1o[E.1o.3K(6,c)?"28":"1f"](6,c)},28:G(a){9(!a||E.1E(a,[6]).r.K){E.30(6);6.12.3b(6)}},4n:G(){E("*",6).N(G(){E.30(6)});1W(6.1w)6.3b(6.1w)}},G(i,n){E.1b[i]=G(){I 6.N(n,1q)}});E.N(["85","5Z"],G(i,a){H n=a.2p();E.1b[n]=G(h){I 6[0]==18?E.V.1N&&3y["84"+a]||E.5g&&38.33(U.2V["5a"+a],U.1G["5a"+a])||U.1G["5a"+a]:6[0]==U?38.33(U.1G["6n"+a],U.1G["6m"+a]):h==W?(6.K?E.17(6[0],n):S):6.17(n,h.1c==3X?h:h+"2T")}});H C=E.V.1N&&3x(E.V.4s)<83?"(?:[\\\\w*57-]|\\\\\\\\.)":"(?:[\\\\w\\82-\\81*57-]|\\\\\\\\.)",6k=1u 47("^>\\\\s*("+C+"+)"),6i=1u 47("^("+C+"+)(#)("+C+"+)"),6h=1u 47("^([#.]?)("+C+"*)");E.1k({55:{"":"m[2]==\'*\'||15.11(a,m[2])","#":"a.4p(\'22\')==m[2]",":":{80:"im[3]-0",2I:"m[3]-0==i",6E:"m[3]-0==i",3v:"i==0",3u:"i==r.K-1",6f:"i%2==0",6e:"i%2","3v-46":"a.12.4l(\'*\')[0]==a","3u-46":"15.2I(a.12.5p,1,\'4d\')==a","7X-46":"!15.2I(a.12.5p,2,\'4d\')",1D:"a.1w",4n:"!a.1w",7W:"(a.6s||a.7V||15(a).2g()||\'\').1g(m[3])>=0",3R:\'"1P"!=a.O&&15.17(a,"19")!="2s"&&15.17(a,"4C")!="1P"\',1P:\'"1P"==a.O||15.17(a,"19")=="2s"||15.17(a,"4C")=="1P"\',7U:"!a.3c",3c:"a.3c",2Q:"a.2Q",26:"a.26||15.1x(a,\'26\')",2g:"\'2g\'==a.O",4k:"\'4k\'==a.O",5j:"\'5j\'==a.O",54:"\'54\'==a.O",52:"\'52\'==a.O",51:"\'51\'==a.O",6d:"\'6d\'==a.O",6c:"\'6c\'==a.O",2r:\'"2r"==a.O||15.11(a,"2r")\',4t:"/4t|24|6b|2r/i.14(a.11)",3K:"15.1Y(m[3],a).K",7S:"/h\\\\d/i.14(a.11)",7R:"15.2W(15.32,G(1b){I a==1b.T;}).K"}},6a:[/^(\\[) *@?([\\w-]+) *([!*$^~=]*) *(\'?"?)(.*?)\\4 *\\]/,/^(:)([\\w-]+)\\("?\'?(.*?(\\(.*?\\))?[^(]*?)"?\'?\\)/,1u 47("^([:.#]*)("+C+"+)")],3m:G(a,c,b){H d,2b=[];1W(a&&a!=d){d=a;H f=E.1E(a,c,b);a=f.t.1p(/^\\s*,\\s*/,"");2b=b?c=f.r:E.1R(2b,f.r)}I 2b},1Y:G(t,o){9(1m t!="1M")I[t];9(o&&!o.1y)o=S;o=o||U;H d=[o],2f=[],3u;1W(t&&3u!=t){H r=[];3u=t;t=E.36(t);H l=P;H g=6k;H m=g.2S(t);9(m){H p=m[1].27();L(H i=0;d[i];i++)L(H c=d[i].1w;c;c=c.2q)9(c.1y==1&&(p=="*"||c.11.27()==p.27()))r.1a(c);d=r;t=t.1p(g,"");9(t.1g(" ")==0)6r;l=Q}J{g=/^([>+~])\\s*(\\w*)/i;9((m=g.2S(t))!=S){r=[];H p=m[2],1R={};m=m[1];L(H j=0,31=d.K;j<31;j++){H n=m=="~"||m=="+"?d[j].2q:d[j].1w;L(;n;n=n.2q)9(n.1y==1){H h=E.M(n);9(m=="~"&&1R[h])1T;9(!p||n.11.27()==p.27()){9(m=="~")1R[h]=Q;r.1a(n)}9(m=="+")1T}}d=r;t=E.36(t.1p(g,""));l=Q}}9(t&&!l){9(!t.1g(",")){9(o==d[0])d.44();2f=E.1R(2f,d);r=d=[o];t=" "+t.68(1,t.K)}J{H k=6i;H m=k.2S(t);9(m){m=[0,m[2],m[3],m[1]]}J{k=6h;m=k.2S(t)}m[2]=m[2].1p(/\\\\/g,"");H f=d[d.K-1];9(m[1]=="#"&&f&&f.3S&&!E.4a(f)){H q=f.3S(m[2]);9((E.V.1h||E.V.34)&&q&&1m q.22=="1M"&&q.22!=m[2])q=E(\'[@22="\'+m[2]+\'"]\',f)[0];d=r=q&&(!m[3]||E.11(q,m[3]))?[q]:[]}J{L(H i=0;d[i];i++){H a=m[1]=="#"&&m[3]?m[3]:m[1]!=""||m[0]==""?"*":m[2];9(a=="*"&&d[i].11.2p()=="5i")a="3a";r=E.1R(r,d[i].4l(a))}9(m[1]==".")r=E.4X(r,m[2]);9(m[1]=="#"){H e=[];L(H i=0;r[i];i++)9(r[i].4p("22")==m[2]){e=[r[i]];1T}r=e}d=r}t=t.1p(k,"")}}9(t){H b=E.1E(t,r);d=r=b.r;t=E.36(b.t)}}9(t)d=[];9(d&&o==d[0])d.44();2f=E.1R(2f,d);I 2f},4X:G(r,m,a){m=" "+m+" ";H c=[];L(H i=0;r[i];i++){H b=(" "+r[i].1o+" ").1g(m)>=0;9(!a&&b||a&&!b)c.1a(r[i])}I c},1E:G(t,r,h){H d;1W(t&&t!=d){d=t;H p=E.6a,m;L(H i=0;p[i];i++){m=p[i].2S(t);9(m){t=t.7O(m[0].K);m[2]=m[2].1p(/\\\\/g,"");1T}}9(!m)1T;9(m[1]==":"&&m[2]=="5V")r=E.1E(m[3],r,Q).r;J 9(m[1]==".")r=E.4X(r,m[2],h);J 9(m[1]=="["){H g=[],O=m[3];L(H i=0,31=r.K;i<31;i++){H a=r[i],z=a[E.5o[m[2]]||m[2]];9(z==S||/6C|3k|26/.14(m[2]))z=E.1x(a,m[2])||\'\';9((O==""&&!!z||O=="="&&z==m[5]||O=="!="&&z!=m[5]||O=="^="&&z&&!z.1g(m[5])||O=="$="&&z.68(z.K-m[5].K)==m[5]||(O=="*="||O=="~=")&&z.1g(m[5])>=0)^h)g.1a(a)}r=g}J 9(m[1]==":"&&m[2]=="2I-46"){H e={},g=[],14=/(\\d*)n\\+?(\\d*)/.2S(m[3]=="6f"&&"2n"||m[3]=="6e"&&"2n+1"||!/\\D/.14(m[3])&&"n+"+m[3]||m[3]),3v=(14[1]||1)-0,d=14[2]-0;L(H i=0,31=r.K;i<31;i++){H j=r[i],12=j.12,22=E.M(12);9(!e[22]){H c=1;L(H n=12.1w;n;n=n.2q)9(n.1y==1)n.4U=c++;e[22]=Q}H b=P;9(3v==1){9(d==0||j.4U==d)b=Q}J 9((j.4U+d)%3v==0)b=Q;9(b^h)g.1a(j)}r=g}J{H f=E.55[m[1]];9(1m f!="1M")f=E.55[m[1]][m[2]];f=3w("P||G(a,i){I "+f+"}");r=E.2W(r,f,h)}}I{r:r,t:t}},4e:G(b,c){H d=[];H a=b[c];1W(a&&a!=U){9(a.1y==1)d.1a(a);a=a[c]}I d},2I:G(a,e,c,b){e=e||1;H d=0;L(;a;a=a[c])9(a.1y==1&&++d==e)1T;I a},5d:G(n,a){H r=[];L(;n;n=n.2q){9(n.1y==1&&(!a||n!=a))r.1a(n)}I r}});E.1j={1f:G(g,e,c,h){9(E.V.1h&&g.4j!=W)g=18;9(!c.2u)c.2u=6.2u++;9(h!=W){H d=c;c=G(){I d.16(6,1q)};c.M=h;c.2u=d.2u}H i=e.2l(".");e=i[0];c.O=i[1];H b=E.M(g,"2P")||E.M(g,"2P",{});H f=E.M(g,"2t",G(){H a;9(1m E=="W"||E.1j.4T)I a;a=E.1j.2t.16(g,1q);I a});H j=b[e];9(!j){j=b[e]={};9(g.4S)g.4S(e,f,P);J g.7N("43"+e,f)}j[c.2u]=c;6.1Z[e]=Q},2u:1,1Z:{},28:G(d,c,b){H e=E.M(d,"2P"),2L,4I;9(1m c=="1M"){H a=c.2l(".");c=a[0]}9(e){9(c&&c.O){b=c.4Q;c=c.O}9(!c){L(c 1i e)6.28(d,c)}J 9(e[c]){9(b)2E e[c][b.2u];J L(b 1i e[c])9(!a[1]||e[c][b].O==a[1])2E e[c][b];L(2L 1i e[c])1T;9(!2L){9(d.4P)d.4P(c,E.M(d,"2t"),P);J d.7M("43"+c,E.M(d,"2t"));2L=S;2E e[c]}}L(2L 1i e)1T;9(!2L){E.30(d,"2P");E.30(d,"2t")}}},1F:G(d,b,e,c,f){b=E.2h(b||[]);9(!e){9(6.1Z[d])E("*").1f([18,U]).1F(d,b)}J{H a,2L,1b=E.1n(e[d]||S),4N=!b[0]||!b[0].2M;9(4N)b.4w(6.4M({O:d,2m:e}));b[0].O=d;9(E.1n(E.M(e,"2t")))a=E.M(e,"2t").16(e,b);9(!1b&&e["43"+d]&&e["43"+d].16(e,b)===P)a=P;9(4N)b.44();9(f&&f.16(e,b)===P)a=P;9(1b&&c!==P&&a!==P&&!(E.11(e,\'a\')&&d=="4L")){6.4T=Q;e[d]()}6.4T=P}I a},2t:G(d){H a;d=E.1j.4M(d||18.1j||{});H b=d.O.2l(".");d.O=b[0];H c=E.M(6,"2P")&&E.M(6,"2P")[d.O],3q=1B.3A.2J.2O(1q,1);3q.4w(d);L(H j 1i c){3q[0].4Q=c[j];3q[0].M=c[j].M;9(!b[1]||c[j].O==b[1]){H e=c[j].16(6,3q);9(a!==P)a=e;9(e===P){d.2M();d.3p()}}}9(E.V.1h)d.2m=d.2M=d.3p=d.4Q=d.M=S;I a},4M:G(c){H a=c;c=E.1k({},a);c.2M=G(){9(a.2M)a.2M();a.7L=P};c.3p=G(){9(a.3p)a.3p();a.7K=Q};9(!c.2m&&c.65)c.2m=c.65;9(E.V.1N&&c.2m.1y==3)c.2m=a.2m.12;9(!c.4K&&c.4J)c.4K=c.4J==c.2m?c.7H:c.4J;9(c.64==S&&c.63!=S){H e=U.2V,b=U.1G;c.64=c.63+(e&&e.2R||b.2R||0);c.7E=c.7D+(e&&e.2B||b.2B||0)}9(!c.3Y&&(c.61||c.60))c.3Y=c.61||c.60;9(!c.5F&&c.5D)c.5F=c.5D;9(!c.3Y&&c.2r)c.3Y=(c.2r&1?1:(c.2r&2?3:(c.2r&4?2:0)));I c}};E.1b.1k({3W:G(c,a,b){I c=="5Y"?6.2G(c,a,b):6.N(G(){E.1j.1f(6,c,b||a,b&&a)})},2G:G(d,b,c){I 6.N(G(){E.1j.1f(6,d,G(a){E(6).5X(a);I(c||b).16(6,1q)},c&&b)})},5X:G(a,b){I 6.N(G(){E.1j.28(6,a,b)})},1F:G(c,a,b){I 6.N(G(){E.1j.1F(c,a,6,Q,b)})},7x:G(c,a,b){9(6[0])I E.1j.1F(c,a,6[0],P,b)},25:G(){H a=1q;I 6.4L(G(e){6.4H=0==6.4H?1:0;e.2M();I a[6.4H].16(6,[e])||P})},7v:G(f,g){G 4G(e){H p=e.4K;1W(p&&p!=6)2a{p=p.12}29(e){p=6};9(p==6)I P;I(e.O=="4x"?f:g).16(6,[e])}I 6.4x(4G).5U(4G)},2d:G(f){5T();9(E.3T)f.16(U,[E]);J E.3l.1a(G(){I f.16(6,[E])});I 6}});E.1k({3T:P,3l:[],2d:G(){9(!E.3T){E.3T=Q;9(E.3l){E.N(E.3l,G(){6.16(U)});E.3l=S}9(E.V.35||E.V.34)U.4P("5S",E.2d,P);9(!18.7t.K)E(18).39(G(){E("#4E").28()})}}});E.N(("7s,7r,39,7q,6n,5Y,4L,7p,"+"7n,7m,7l,4x,5U,7k,24,"+"51,7j,7i,7h,3U").2l(","),G(i,o){E.1b[o]=G(f){I f?6.3W(o,f):6.1F(o)}});H x=P;G 5T(){9(x)I;x=Q;9(E.V.35||E.V.34)U.4S("5S",E.2d,P);J 9(E.V.1h){U.7f("<7d"+"7y 22=4E 7z=Q "+"3k=//:><\\/1J>");H a=U.3S("4E");9(a)a.62=G(){9(6.2C!="1l")I;E.2d()};a=S}J 9(E.V.1N)E.4B=4j(G(){9(U.2C=="5Q"||U.2C=="1l"){4A(E.4B);E.4B=S;E.2d()}},10);E.1j.1f(18,"39",E.2d)}E.1b.1k({39:G(g,d,c){9(E.1n(g))I 6.3W("39",g);H e=g.1g(" ");9(e>=0){H i=g.2J(e,g.K);g=g.2J(0,e)}c=c||G(){};H f="4z";9(d)9(E.1n(d)){c=d;d=S}J{d=E.3a(d);f="5P"}H h=6;E.3G({1d:g,O:f,M:d,1l:G(a,b){9(b=="1C"||b=="5O")h.4o(i?E("<1s/>").3g(a.40.1p(/<1J(.|\\s)*?\\/1J>/g,"")).1Y(i):a.40);56(G(){h.N(c,[a.40,b,a])},13)}});I 6},7a:G(){I E.3a(6.5M())},5M:G(){I 6.1X(G(){I E.11(6,"2Y")?E.2h(6.79):6}).1E(G(){I 6.2H&&!6.3c&&(6.2Q||/24|6b/i.14(6.11)||/2g|1P|52/i.14(6.O))}).1X(G(i,c){H b=E(6).3i();I b==S?S:b.1c==1B?E.1X(b,G(a,i){I{2H:c.2H,1Q:a}}):{2H:c.2H,1Q:b}}).21()}});E.N("5L,5K,6t,5J,5I,5H".2l(","),G(i,o){E.1b[o]=G(f){I 6.3W(o,f)}});H B=(1u 3D).3B();E.1k({21:G(d,b,a,c){9(E.1n(b)){a=b;b=S}I E.3G({O:"4z",1d:d,M:b,1C:a,1V:c})},78:G(b,a){I E.21(b,S,a,"1J")},77:G(c,b,a){I E.21(c,b,a,"45")},76:G(d,b,a,c){9(E.1n(b)){a=b;b={}}I E.3G({O:"5P",1d:d,M:b,1C:a,1V:c})},75:G(a){E.1k(E.59,a)},59:{1Z:Q,O:"4z",2z:0,5G:"74/x-73-2Y-72",6o:Q,3e:Q,M:S},49:{},3G:G(s){H f,2y=/=(\\?|%3F)/g,1v,M;s=E.1k(Q,s,E.1k(Q,{},E.59,s));9(s.M&&s.6o&&1m s.M!="1M")s.M=E.3a(s.M);9(s.1V=="4b"){9(s.O.2p()=="21"){9(!s.1d.1t(2y))s.1d+=(s.1d.1t(/\\?/)?"&":"?")+(s.4b||"5E")+"=?"}J 9(!s.M||!s.M.1t(2y))s.M=(s.M?s.M+"&":"")+(s.4b||"5E")+"=?";s.1V="45"}9(s.1V=="45"&&(s.M&&s.M.1t(2y)||s.1d.1t(2y))){f="4b"+B++;9(s.M)s.M=s.M.1p(2y,"="+f);s.1d=s.1d.1p(2y,"="+f);s.1V="1J";18[f]=G(a){M=a;1C();1l();18[f]=W;2a{2E 18[f]}29(e){}}}9(s.1V=="1J"&&s.1L==S)s.1L=P;9(s.1L===P&&s.O.2p()=="21")s.1d+=(s.1d.1t(/\\?/)?"&":"?")+"57="+(1u 3D()).3B();9(s.M&&s.O.2p()=="21"){s.1d+=(s.1d.1t(/\\?/)?"&":"?")+s.M;s.M=S}9(s.1Z&&!E.5b++)E.1j.1F("5L");9(!s.1d.1g("8g")&&s.1V=="1J"){H h=U.4l("9U")[0];H g=U.5B("1J");g.3k=s.1d;9(!f&&(s.1C||s.1l)){H j=P;g.9R=g.62=G(){9(!j&&(!6.2C||6.2C=="5Q"||6.2C=="1l")){j=Q;1C();1l();h.3b(g)}}}h.58(g);I}H k=P;H i=18.6X?1u 6X("9P.9O"):1u 6W();i.9M(s.O,s.1d,s.3e);9(s.M)i.5C("9J-9I",s.5G);9(s.5y)i.5C("9H-5x-9F",E.49[s.1d]||"9D, 9C 9B 9A 5v:5v:5v 9z");i.5C("X-9x-9v","6W");9(s.6U)s.6U(i);9(s.1Z)E.1j.1F("5H",[i,s]);H c=G(a){9(!k&&i&&(i.2C==4||a=="2z")){k=Q;9(d){4A(d);d=S}1v=a=="2z"&&"2z"||!E.6S(i)&&"3U"||s.5y&&E.6R(i,s.1d)&&"5O"||"1C";9(1v=="1C"){2a{M=E.6Q(i,s.1V)}29(e){1v="5k"}}9(1v=="1C"){H b;2a{b=i.5s("6P-5x")}29(e){}9(s.5y&&b)E.49[s.1d]=b;9(!f)1C()}J E.5r(s,i,1v);1l();9(s.3e)i=S}};9(s.3e){H d=4j(c,13);9(s.2z>0)56(G(){9(i){i.9q();9(!k)c("2z")}},s.2z)}2a{i.9o(s.M)}29(e){E.5r(s,i,S,e)}9(!s.3e)c();I i;G 1C(){9(s.1C)s.1C(M,1v);9(s.1Z)E.1j.1F("5I",[i,s])}G 1l(){9(s.1l)s.1l(i,1v);9(s.1Z)E.1j.1F("6t",[i,s]);9(s.1Z&&!--E.5b)E.1j.1F("5K")}},5r:G(s,a,b,e){9(s.3U)s.3U(a,b,e);9(s.1Z)E.1j.1F("5J",[a,s,e])},5b:0,6S:G(r){2a{I!r.1v&&9n.9l=="54:"||(r.1v>=6N&&r.1v<9j)||r.1v==6M||E.V.1N&&r.1v==W}29(e){}I P},6R:G(a,c){2a{H b=a.5s("6P-5x");I a.1v==6M||b==E.49[c]||E.V.1N&&a.1v==W}29(e){}I P},6Q:G(r,b){H c=r.5s("9i-O");H d=b=="6K"||!b&&c&&c.1g("6K")>=0;H a=d?r.9g:r.40;9(d&&a.2V.37=="5k")6G"5k";9(b=="1J")E.5f(a);9(b=="45")a=3w("("+a+")");I a},3a:G(a){H s=[];9(a.1c==1B||a.4c)E.N(a,G(){s.1a(3f(6.2H)+"="+3f(6.1Q))});J L(H j 1i a)9(a[j]&&a[j].1c==1B)E.N(a[j],G(){s.1a(3f(j)+"="+3f(6))});J s.1a(3f(j)+"="+3f(a[j]));I s.66("&").1p(/%20/g,"+")}});E.1b.1k({1A:G(b,a){I b?6.1U({1H:"1A",2N:"1A",1r:"1A"},b,a):6.1E(":1P").N(G(){6.R.19=6.3h?6.3h:"";9(E.17(6,"19")=="2s")6.R.19="2Z"}).2D()},1z:G(b,a){I b?6.1U({1H:"1z",2N:"1z",1r:"1z"},b,a):6.1E(":3R").N(G(){6.3h=6.3h||E.17(6,"19");9(6.3h=="2s")6.3h="2Z";6.R.19="2s"}).2D()},6J:E.1b.25,25:G(a,b){I E.1n(a)&&E.1n(b)?6.6J(a,b):a?6.1U({1H:"25",2N:"25",1r:"25"},a,b):6.N(G(){E(6)[E(6).3t(":1P")?"1A":"1z"]()})},9c:G(b,a){I 6.1U({1H:"1A"},b,a)},9b:G(b,a){I 6.1U({1H:"1z"},b,a)},99:G(b,a){I 6.1U({1H:"25"},b,a)},98:G(b,a){I 6.1U({1r:"1A"},b,a)},96:G(b,a){I 6.1U({1r:"1z"},b,a)},95:G(c,a,b){I 6.1U({1r:a},c,b)},1U:G(k,i,h,g){H j=E.6D(i,h,g);I 6[j.3L===P?"N":"3L"](G(){j=E.1k({},j);H f=E(6).3t(":1P"),3y=6;L(H p 1i k){9(k[p]=="1z"&&f||k[p]=="1A"&&!f)I E.1n(j.1l)&&j.1l.16(6);9(p=="1H"||p=="2N"){j.19=E.17(6,"19");j.2U=6.R.2U}}9(j.2U!=S)6.R.2U="1P";j.3M=E.1k({},k);E.N(k,G(c,a){H e=1u E.2j(3y,j,c);9(/25|1A|1z/.14(a))e[a=="25"?f?"1A":"1z":a](k);J{H b=a.3s().1t(/^([+-]=)?([\\d+-.]+)(.*)$/),1O=e.2b(Q)||0;9(b){H d=3I(b[2]),2i=b[3]||"2T";9(2i!="2T"){3y.R[c]=(d||1)+2i;1O=((d||1)/e.2b(Q))*1O;3y.R[c]=1O+2i}9(b[1])d=((b[1]=="-="?-1:1)*d)+1O;e.3N(1O,d,2i)}J e.3N(1O,a,"")}});I Q})},3L:G(a,b){9(E.1n(a)){b=a;a="2j"}9(!a||(1m a=="1M"&&!b))I A(6[0],a);I 6.N(G(){9(b.1c==1B)A(6,a,b);J{A(6,a).1a(b);9(A(6,a).K==1)b.16(6)}})},9f:G(){H a=E.32;I 6.N(G(){L(H i=0;i-8O?r:3I(E.17(6.T,6.1e))||0},3N:G(c,b,e){6.5u=(1u 3D()).3B();6.1O=c;6.2D=b;6.2i=e||6.2i||"2T";6.2v=6.1O;6.4q=6.4i=0;6.4r();H f=6;G t(){I f.2F()}t.T=6.T;E.32.1a(t);9(E.32.K==1){H d=4j(G(){H a=E.32;L(H i=0;i6.Y.2e+6.5u){6.2v=6.2D;6.4q=6.4i=1;6.4r();6.Y.3M[6.1e]=Q;H a=Q;L(H i 1i 6.Y.3M)9(6.Y.3M[i]!==Q)a=P;9(a){9(6.Y.19!=S){6.T.R.2U=6.Y.2U;6.T.R.19=6.Y.19;9(E.17(6.T,"19")=="2s")6.T.R.19="2Z"}9(6.Y.1z)6.T.R.19="2s";9(6.Y.1z||6.Y.1A)L(H p 1i 6.Y.3M)E.1x(6.T.R,p,6.Y.3P[p])}9(a&&E.1n(6.Y.1l))6.Y.1l.16(6.T);I P}J{H n=t-6.5u;6.4i=n/6.Y.2e;6.4q=E.3J[6.Y.3J||(E.3J.5q?"5q":"6B")](6.4i,n,0,1,6.Y.2e);6.2v=6.1O+((6.2D-6.1O)*6.4q);6.4r()}I Q}};E.2j.2F={2R:G(a){a.T.2R=a.2v},2B:G(a){a.T.2B=a.2v},1r:G(a){E.1x(a.T.R,"1r",a.2v)},6z:G(a){a.T.R[a.1e]=a.2v+a.2i}};E.1b.6m=G(){H c=0,3E=0,T=6[0],5t;9(T)8L(E.V){H b=E.17(T,"2X")=="4F",1D=T.12,23=T.23,2K=T.3H,4f=1N&&3x(4s)<8J;9(T.6V){5w=T.6V();1f(5w.1S+38.33(2K.2V.2R,2K.1G.2R),5w.3E+38.33(2K.2V.2B,2K.1G.2B));9(1h){H d=E("4o").17("8H");d=(d=="8G"||E.5g&&3x(4s)>=7)&&2||d;1f(-d,-d)}}J{1f(T.5l,T.5z);1W(23){1f(23.5l,23.5z);9(35&&/^t[d|h]$/i.14(1D.37)||!4f)d(23);9(4f&&!b&&E.17(23,"2X")=="4F")b=Q;23=23.23}1W(1D.37&&!/^1G|4o$/i.14(1D.37)){9(!/^8D|1I-9S.*$/i.14(E.17(1D,"19")))1f(-1D.2R,-1D.2B);9(35&&E.17(1D,"2U")!="3R")d(1D);1D=1D.12}9(4f&&b)1f(-2K.1G.5l,-2K.1G.5z)}5t={3E:3E,1S:c}}I 5t;G d(a){1f(E.17(a,"9T"),E.17(a,"8A"))}G 1f(l,t){c+=3x(l)||0;3E+=3x(t)||0}}})();',62,616,'||||||this|||if|||||||||||||||||||||||||||||||||function|var|return|else|length|for|data|each|type|false|true|style|null|elem|document|browser|undefined||options|||nodeName|parentNode||test|jQuery|apply|css|window|display|push|fn|constructor|url|prop|add|indexOf|msie|in|event|extend|complete|typeof|isFunction|className|replace|arguments|opacity|div|match|new|status|firstChild|attr|nodeType|hide|show|Array|success|parent|filter|trigger|body|height|table|script|tbody|cache|string|safari|start|hidden|value|merge|left|break|animate|dataType|while|map|find|global||get|id|offsetParent|select|toggle|selected|toUpperCase|remove|catch|try|cur|al|ready|duration|done|text|makeArray|unit|fx|swap|split|target||pushStack|toLowerCase|nextSibling|button|none|handle|guid|now|stack|tb|jsre|timeout|inArray|scrollTop|readyState|end|delete|step|one|name|nth|slice|doc|ret|preventDefault|width|call|events|checked|scrollLeft|exec|px|overflow|documentElement|grep|position|form|block|removeData|rl|timers|max|opera|mozilla|trim|tagName|Math|load|param|removeChild|disabled|insertBefore|async|encodeURIComponent|append|oldblock|val|childNodes|src|readyList|multiFilter|color|defaultView|stopPropagation|args|old|toString|is|last|first|eval|parseInt|self|domManip|prototype|getTime|curCSS|Date|top||ajax|ownerDocument|parseFloat|easing|has|queue|curAnim|custom|innerHTML|orig|currentStyle|visible|getElementById|isReady|error|static|bind|String|which|getComputedStyle|responseText|oWidth|oHeight|on|shift|json|child|RegExp|ol|lastModified|isXMLDoc|jsonp|jquery|previousSibling|dir|safari2|el|styleFloat|state|setInterval|radio|getElementsByTagName|tr|empty|html|getAttribute|pos|update|version|input|float|runtimeStyle|unshift|mouseover|getPropertyValue|GET|clearInterval|safariTimer|visibility|clean|__ie_init|absolute|handleHover|lastToggle|index|fromElement|relatedTarget|click|fix|evt|andSelf|removeEventListener|handler|cloneNode|addEventListener|triggered|nodeIndex|unique|Number|classFilter|prevObject|selectedIndex|after|submit|password|removeAttribute|file|expr|setTimeout|_|appendChild|ajaxSettings|client|active|win|sibling|deep|globalEval|boxModel|cssFloat|object|checkbox|parsererror|offsetLeft|wrapAll|dequeue|props|lastChild|swing|handleError|getResponseHeader|results|startTime|00|box|Modified|ifModified|offsetTop|evalScript|createElement|setRequestHeader|ctrlKey|callback|metaKey|contentType|ajaxSend|ajaxSuccess|ajaxError|ajaxStop|ajaxStart|serializeArray|init|notmodified|POST|loaded|appendTo|DOMContentLoaded|bindReady|mouseout|not|removeAttr|unbind|unload|Width|keyCode|charCode|onreadystatechange|clientX|pageX|srcElement|join|outerHTML|substr|zoom|parse|textarea|reset|image|odd|even|before|quickClass|quickID|prepend|quickChild|execScript|offset|scroll|processData|uuid|contents|continue|textContent|ajaxComplete|clone|setArray|webkit|nodeValue|fl|_default|100|linear|href|speed|eq|createTextNode|throw|replaceWith|splice|_toggle|xml|colgroup|304|200|alpha|Last|httpData|httpNotModified|httpSuccess|fieldset|beforeSend|getBoundingClientRect|XMLHttpRequest|ActiveXObject|col|br|abbr|pixelLeft|urlencoded|www|application|ajaxSetup|post|getJSON|getScript|elements|serialize|clientWidth|hasClass|scr|clientHeight|write|relative|keyup|keypress|keydown|change|mousemove|mouseup|mousedown|right|dblclick|resize|focus|blur|frames|instanceof|hover|offsetWidth|triggerHandler|ipt|defer|offsetHeight|border|padding|clientY|pageY|Left|Right|toElement|Bottom|Top|cancelBubble|returnValue|detachEvent|attachEvent|substring|line|weight|animated|header|font|enabled|innerText|contains|only|size|gt|lt|uFFFF|u0128|417|inner|Height|toggleClass|removeClass|addClass|replaceAll|noConflict|insertAfter|prependTo|wrap|contentWindow|contentDocument|http|iframe|children|siblings|prevAll|nextAll|wrapInner|prev|Boolean|next|parents|maxLength|maxlength|readOnly|readonly|class|htmlFor|CSS1Compat|compatMode|compatible|borderTopWidth|ie|ra|inline|it|rv|medium|borderWidth|userAgent|522|navigator|with|concat|1px|10000|array|ig|PI|NaN|400|reverse|fast|600|slow|Function|Object|setAttribute|changed|be|can|property|fadeTo|fadeOut|getAttributeNode|fadeIn|slideToggle|method|slideUp|slideDown|action|cssText|stop|responseXML|option|content|300|th|protocol|td|location|send|cap|abort|colg|cos|tfoot|thead|With|leg|Requested|opt|GMT|1970|Jan|01|Thu|area|Since|hr|If|Type|Content|meta|specified|open|link|XMLHTTP|Microsoft|img|onload|row|borderLeftWidth|head|attributes'.split('|'),0,{}); + +/* + Copyright (c) 2004-2007, The Dojo Foundation + All Rights Reserved. + + Licensed under the Academic Free License version 2.1 or above OR the + modified BSD license. For more information on Dojo licensing, see: + + http://dojotoolkit.org/community/licensing.shtml +*/ + +/* + This is a compiled version of Dojo, built for deployment and not for + development. To get an editable version, please visit: + + http://dojotoolkit.org + + for documentation and information on getting the source. +*/ + +var decompressedDojo = function(p,a,c,k,e,d){e=function(c){return(c35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--)d[e(c)]=k[c]||e(c);k=[function(e){return d[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('if(V z=="1k"){(B(){if(V D["1o"]=="1k"){D.1o={}}if((!D["1z"])||(!1z["ca"])){D.1z={}}A cn=["rA","rz","1K","ry","rx","9f","rw","rv","ru","rt","rs","rr","rq","ro","rn","rm"];A i=0,24;1s(24=cn[i++]){if(!1z[24]){1z[24]=B(){}}}if(V D["z"]=="1k"){D.z={}}z.1W=D;A d3={im:U,rl:U,rk:"",rj:"",ri:"",rh:K,rg:U};R(A 8z in d3){if(V 1o[8z]=="1k"){1o[8z]=d3[8z]}}A jK=["rf","rd","rc","rb"];A t;1s(t=jK.3a()){z["is"+t]=U}})();z.8h=1o.8h;z.cY={jJ:0,jI:9,jH:0,jG:"",jF:2V("$ra: r9 $".1f(/[0-9]+/)[0]),2i:B(){4G(z.cY){C jJ+"."+jI+"."+jH+jG+" ("+jF+")"}}};z.d1=B(jE,jD,1V){A 2h=1V||z.1W;R(A i=0,p;2h&&(p=jE[i]);i++){2h=(p in 2h?2h[p]:(jD?2h[p]={}:1k))}C 2h};z.88=B(jC,jA,jB){A d2=jC.1A("."),p=d2.8q(),M=z.d1(d2,K,jB);C(M&&p?(M[p]=jA):1k)};z.6q=B(jz,jy,jx){C z.d1(jz.1A("."),jy,jx)};z.r8=B(jw,M){C!!z.6q(jw,U,M)};z["3u"]=B(d0){C z.1W.3u?z.1W.3u(d0):3u(d0)};z.ia=B(jv,cZ,cX){A 8y="r7: "+jv;if(cZ){8y+=" "+cZ}if(cX){8y+=" -- r6 be r5 in cY: "+cX}1z.1K(8y)};z.r4=B(ju,cW){A cV="r3: "+ju+" -- r2 r1 4F r0 qZ qY.";if(cW){cV+=" "+cW}1z.1K(cV)};(B(){A cR={53:{},6p:0,1h:{},8k:{z:{1p:"z",1Z:"."},cU:{1p:"cU",1Z:"../qX/cU"},cT:{1p:"cT",1Z:"cT"}},cN:B(cS){A mp=D.8k;C jp(mp[cS]&&mp[cS].1Z)},jk:B(8x){A mp=D.8k;if(D.cN(8x)){C mp[8x].1Z}C 8x},8v:[],6t:U,56:[],8t:[],8u:U};R(A cQ in cR){z[cQ]=cR[cQ]}})();z.jg=B(8w,cP,cb){A 1g=(((8w.2s(0)=="/"||8w.1f(/^\\w+:/)))?"":D.51)+8w;if(1o.jt&&z.c8){1g+="?"+67(1o.jt).2f(/\\W+/g,"")}1u{C!cP?D.cO(1g,cb):D.jq(1g,cP,cb)}1y(e){1z.1K(e);C U}};z.cO=B(1g,cb){if(D.8v[1g]){C K}A 6u=D.iR(1g,K);if(!6u){C U}D.8v[1g]=K;D.8v.Y(1g);if(cb){6u="("+6u+")"}A jr=z["3u"](6u+"\\r\\n//@ qW="+1g);if(cb){cb(jr)}C K};z.jq=B(1g,jo,cb){A ok=U;1u{ok=D.cO(1g,cb)}1y(e){1z.1K("qV je ",1g," 4G 9f: ",e)}C jp(ok&&D.53[jo])};z.6m=B(){D.8u=K;D.6t=K;A 57=D.56;D.56=[];R(A x=0;x<57.G;x++){57[x]()}D.8u=U;if(z.6t&&z.6p==0&&D.56.G>0){z.8s()}};z.ck=B(){A 57=D.8t;1s(57.G){(57.8q())()}};z.qU=B(M,jn){A d=z;if(P.G==1){d.56.Y(M)}I{if(P.G>1){d.56.Y(B(){M[jn]()})}}if(d.6t&&d.6p==0&&!d.8u){d.8s()}};z.dW=B(M,jm){A d=z;if(P.G==1){d.8t.Y(M)}I{if(P.G>1){d.8t.Y(B(){M[jm]()})}}};z.iM=B(){if(D.6t){C}if(D.6p>0){1z.1K("qT qS in qR!");C}z.8s()};z.8s=B(){if(V 5c=="8b"||(1o["qQ"]&&z.2M)){5c("z.6m();",0)}I{z.6m()}};z.cF=B(jl){A 4v=jl.1A(".");R(A i=4v.G;i>0;i--){A 8r=4v.2w(0,i).22(".");if((i==1)&&!D.cN(8r)){4v[0]="../"+4v[0]}I{A cM=D.jk(8r);if(cM!=8r){4v.3S(0,i,cM);3f}}}C 4v};z.jj=U;z.8m=B(2T,qP,55){55=D.jj||55;A 54=D.53[2T];if(54){C 54}A cL=2T.1A(".");A 3L=D.cF(2T);A jh=((3L[0].2s(0)!="/")&&!3L[0].1f(/^\\w+:/));A ji=3L[3L.G-1];A 3m;if(ji=="*"){2T=cL.2w(0,-1).22(".");3L.8q();3m=3L.22("/")+"/"+(1o["qO"]||"qN")+".js";if(jh&&3m.2s(0)=="/"){3m=3m.2w(1)}}I{3m=3L.22("/")+".js";2T=cL.22(".")}A jf=(!55)?2T:L;A ok=D.jg(3m,jf);if((!ok)&&(!55)){2m S 1O("qM 3O 4E \'"+2T+"\'; 72 qL \'"+3m+"\'")}if((!55)&&(!D["qK"])){54=D.53[2T];if(!54){2m S 1O("qJ \'"+2T+"\' is 3O qI a8 je \'"+3m+"\'")}}C 54};z.8c=z.8m;z.1Q=B(cK){A cJ=cK+"";A 8p=cJ;A 6s=cK.1A(/\\./);if(6s[6s.G-1]=="*"){6s.8q();8p=6s.22(".")}A 8o=z.6q(8p,K);D.53[cJ]=8o;D.53[8p]=8o;C 8o};z.qH=B(8n){A jd=8n["qG"]||[];A cI=jd.3U(8n[z.j4]||8n["aY"]||[]);R(A x=0;x0&&!(j==1&&1X[0]=="")&&1X[j]==".."&&1X[j-1]!=".."){if(j==(1X.G-1)){1X.3S(j,1);1X[j-1]=""}I{1X.3S(j-1,2);j-=2}}}}1t.28=1X.22("/")}}}}1g="";if(1t.4t){1g+=1t.4t+":"}if(1t.3l){1g+="//"+1t.3l}1g+=1t.28;if(1t.1r){1g+="?"+1t.1r}if(1t.52){1g+="#"+1t.52}}D.1g=1g.2i();A r=D.1g.1f(j7);D.4t=r[2]||(r[1]?"":n);D.3l=r[4]||(r[3]?"":n);D.28=r[5];D.1r=r[7]||(r[6]?"":n);D.52=r[9]||(r[8]?"":n);if(D.3l!=n){r=D.3l.1f(j6);D.8X=r[3]||n;D.8W=r[4]||n;D.qw=r[5];D.qv=r[7]||n}};z.4r.1C.2i=B(){C D.1g}})();z.qu=B(j5,2E){A 2B=z.cF(j5).22("/");if(!2B){C L}if(2B.31("/")!=2B.G-1){2B+="/"}A cE=2B.T(":");if(2B.2s(0)!="/"&&(cE==-1||cE>2B.T("/"))){2B=z.51+2B}C S z.4r(2B,2E)};if(V 26!="1k"){z.c8=K;z.j4="qt";(B(){A d=z;if(1q&&1q.4I){A 8j=1q.4I("ak");A j3=/z(\\.qs)?\\.js([\\?\\.]|$)/i;R(A i=0;i<8j.G;i++){A 4X=8j[i].5t("4X");if(!4X){6c}A m=4X.1f(j3);if(m){if(!1o["51"]){1o["51"]=4X.21(0,m.hK)}A cD=8j[i].5t("1o");if(cD){A cC=3u("({ "+cD+" })");R(A x in cC){1o[x]=cC[x]}}3f}}}d.51=1o["51"];A n=cq;A 8i=n.iL;A 4Z=n.qr;A 6r=2k(4Z);d.2M=(8i.T("qq")>=0)?6r:0;d.6B=(4Z.T("qo")>=0)||(4Z.T("j2")>=0)?6r:0;d.3o=(4Z.T("j2")>=0)?6r:0;A j1=8i.T("qn");d.gu=d.7B=((j1>=0)&&(!d.6B))?6r:0;d.j0=0;d.1l=0;d.iV=0;1u{if(d.7B){d.j0=2k(8i.1A("qm/")[1].1A(" ")[0])}if((1q.gx)&&(!d.2M)){d.1l=2k(4Z.1A("qk ")[1].1A(";")[0])}}1y(e){}if(z.1l&&(26.8f.cu==="9q:")){1o.iT=K}d.iX=B(){A 2A;A qj;A cB=d.6q("cz.cy");if(cB){C cB}if(V iZ!="1k"){2A=S iZ()}I{if(d.1l){1u{2A=S 9j("qi.qh")}1y(e){}}I{if(cq.qg["8Z/x-iY"]){2A=1q.a9("8b");2A.cA("Z","8Z/x-iY");2A.cA("3n",0);2A.cA("58",0);2A.1c.gq="7C";1q.5K.4c(2A)}}}if(!2A){C L}z.88("cz.cy.qf",2A);C z.6q("cz.cy")};A iW=d.iX();if(iW){d.iV=K}A cm=1q["aX"];d.qe=(cm=="aW")||(cm=="gr")||(d.1l<6);d.8h=1o.8h||(d.1l?n.qd:n.qc).1M();d.qb=1z.1K;d.cx=["iU.8g","em.8g","iU.8g.4.0"];d.9b=B(){A 4s=L;A cv=L;if(!z.1l||!1o.iT){1u{4s=S qa()}1y(e){}}if(!4s){R(A i=0;i<3;++i){A cw=z.cx[i];1u{4s=S 9j(cw)}1y(e){cv=e}if(4s){z.cx=[cw];3f}}}if(!4s){2m S 1O("8g 3O q9: "+cv)}C 4s};d.8Y=B(iS){A 4Y=iS.3N||0;C((4Y>=q8)&&(4Y0);d.iR=B(1g,iP){A 3K=D.9b();if(!iQ&&z.4r){1g=(S z.4r(26.8f,1g)).2i()}3K.dL("dD",1g,U);1u{3K.dI(L);if(!d.8Y(3K)){A 1G=1O("q2 4F 4E "+1g+" 3N:"+3K.3N);1G.3N=3K.3N;1G.2G=3K.2G;2m 1G}}1y(e){if(iP){C L}2m e}C 3K.2G}})();z.iO=U;z.6o=B(e){z.iO=K;A cr=(e&&e.Z)?e.Z.1M():"4E";if(P.2O.iN||(cr!="q1"&&cr!="4E")){C}P.2O.iN=K;if(V z["8e"]!="1k"){dX(z.8e);63 z.8e}if(z.6p==0){z.iM()}};if(1q.66){if(z.2M||(z.7B&&(1o["q0"]===K))){1q.66("pZ",z.6o,L)}26.66("4E",z.6o,L)}if(/(pY|pX)/i.6Z(cq.iL)){z.8e=dN(B(){if(/6m|iJ/.6Z(1q.6F)){z.6o()}},10)}(B(){A 3g=26;A 8d=B(cp,fp){A iK=3g[cp]||B(){};3g[cp]=B(){fp.14(3g,P);iK.14(3g,P)}};if(z.1l){1q.fJ(""+"");A co=K;8d("iG",B(){3g.5c(B(){co=U},0)});8d("pU",B(){if(co){z.ck()}});1u{1q.pT.2P("v","pS:pR-pQ-pP:pO");1q.pN().pM("v\\\\:*","pL:2E(#aY#pK)")}1y(e){}}I{8d("iG",B(){z.ck()})}})();z.pJ=B(){};z.1e=26["1q"]||L;z.3E=B(){C z.1e.3E||z.1e.4I("3E")[0]};z.ch=B(iF,iE){z.1W=iF;z.1e=iE};z.cf=B(4q,6n,iD){if((6n)&&((V 4q=="3c")||(4q 1N 67))){4q=6n[4q]}C(6n?4q.14(6n,iD||[]):4q())};z.pI=B(cj,iC,iB,iA){A cg;A iz=z.1W;A iy=z.1e;1u{z.ch(cj,cj.1q);cg=z.cf(iC,iB,iA)}ir{z.ch(iz,iy)}C cg};z.pH=B(ix,iw,iv,iu){A ce;A ip=z.1e;1u{z.1e=ix;ce=z.cf(iw,iv,iu)}ir{z.1e=ip}C ce};if(1o["cd"]){R(A cc in 1o["cd"]){z.io(cc,1o["cd"][cc])}}}if(1o.im){if(!1z.ca){z.8c("z.pG.ca")}}}if(!z.1h["z.X.c9"]){z.1h["z.X.c9"]=K;z.1Q("z.X.c9");z.1R=B(it){C(V it=="3c"||it 1N 67)};z.2l=B(it){C(it&&it 1N 4e||V it=="6a"||((V z["1H"]!="1k")&&(it 1N z.1H)))};if(z.c8&&z.3o){z.1Y=B(it){if((V(it)=="B")&&(it=="[8b 1H]")){C U}C(V it=="B"||it 1N bI)}}I{z.1Y=B(it){C(V it=="B"||it 1N bI)}}z.ib=B(it){if(V it=="1k"){C U}C(it===L||V it=="8b"||z.2l(it)||z.1Y(it))};z.pF=B(it){A d=z;if((!it)||(V it=="1k")){C U}if(d.1R(it)){C U}if(d.1Y(it)){C U}if(d.2l(it)){C K}if((it.5w)&&(it.5w.1M()=="3R")){C U}if(pE(it.G)){C K}C U};z.pD=B(it){if(!it){C U}C!z.1Y(it)&&/\\{\\s*\\[il 5h\\]\\s*\\}/.6Z(67(it))};z.c7=B(M,4W){A 8a={};R(A x in 4W){if((V 8a[x]=="1k")||(8a[x]!=4W[x])){M[x]=4W[x]}}if(z.1l){A p=4W.2i;if((V(p)=="B")&&(p!=M.2i)&&(p!=8a.2i)&&(p!="\\pC 2i() {\\n [il 5h]\\n}\\n")){M.2i=4W.2i}}C M};z.1x=B(M,pB){R(A i=1,l=P.G;i2){C z.ig.14(z,P)}if(!3k){3k=2z;2z=L}if(z.1R(3k)){2z=2z||z.1W;if(!2z[3k]){2m(["z.2p: ie[\\"",3k,"\\"] is L (ie=\\"",2z,"\\")"].22(""))}C B(){C 2z[3k].14(2z,P||[])}}I{C(!2z?3k:B(){C 3k.14(2z,P||[])})}};z.6j=B(M,c3){B c4(){};c4.1C=M;A c2=S c4();if(c3){z.1x(c2,c3)}C c2};z.7X=B(pz){A Q=[L];C z.2p.14(z,Q.3U(z.4d(P)))};z.4d=B(M,ic){A Q=[];R(A x=ic||0;x3)){z.ia("z.2r: R 9P \'"+6l+"\' py pw B as \'1P\' pv pu of as a pt i3.","","1.0");A c=3j;3j=P[3]||{};3j.1P=c}A dd=P.2O,4V=L;if(z.2l(4p)){4V=4p;4p=4V.3a()}if(4V){R(A i=0,m;i<4V.G;i++){m=4V[i];if(!m){2m("ps #"+i+" 4F pr of "+6l+" is L. pq\'s pp a po pl is 3O 6m.")}4p=dd.6j(4p,m)}}A i9=(3j||0).1P,6k=dd.6j(4p),fn;R(A i in 3j){if(z.1Y(fn=3j[i])&&(!0[i])){fn.i4=i}}z.4M(6k,{4o:6l,bY:i9,bZ:L},3j||0);6k.1C.1P=6k;C z.88(6l,6k)};z.1x(z.2r,{6j:B(c0,i8){A bp=(c0||0).1C,mp=(i8||0).1C;A 2S=z.2r.i7();z.1x(2S,{84:bp,1x:mp});if(c0){2S.1C=z.6j(bp)}z.4M(2S,z.2r.i6,mp||0,{bY:L});2S.1C.1P=2S;2S.1C.4o=(bp||0).4o+"pk"+(mp||0).4o;z.88(2S.1C.4o,2S);C 2S},i7:B(){C B(){D.i5(P)}},i6:{i5:B(86){A c=86.2O,s=c.84,ct=s&&s.1P,m=c.1x,87=m&&m.1P,a=86,ii,fn;if(a[0]){if((fn=a[0]["bZ"])){a=fn.14(D,a)||a}}if(fn=c.1C.bZ){a=fn.14(D,a)||a}if(ct&&ct.14){ct.14(D,a)}if(87&&87.14){87.14(D,a)}if(ii=c.1C.bY){ii.14(D,86)}},bX:B(85){A c=D.1P,p,m;1s(c){p=c.84;m=c.1x;if(m==85||(m 1N 85.1P)){C p}if(m&&(m=m.bX(85))){C m}c=p&&p.1P}},6h:B(83,82,bW,6i){A p=bW,c,m,f;do{c=p.1P;m=c.1x;if(m&&(m=D.6h(83,82,m,6i))){C m}if((f=p[83])&&(6i==(f==82))){C p}p=c.84}1s(p);C!6i&&(p=D.bX(bW))&&D.6h(83,82,p,6i)},bU:B(2R,4U,bV){A a=P;if(!z.1R(a[0])){bV=4U;4U=2R;2R=4U.2O.i4}A c=4U.2O,p=D.1P.1C,a=bV||4U,fn,mp;if(D[2R]!=c||p[2R]==c){mp=D.6h(2R,c,p,K);if(!mp){2m(D.4o+": 1p i3 (\\""+2R+"\\") 4F bU pj 1f 2O (2r.js)")}p=D.6h(2R,c,mp,U)}fn=p&&p[2R];if(!fn){1z.1K(mp.4o+": no bU \\""+2R+"\\" ph pg (2r.js)");C}C fn.14(D,a)}}})}if(!z.1h["z.X.2c"]){z.1h["z.X.2c"]=K;z.1Q("z.X.2c");z.3i={i2:B(){C B(){A ap=4e.1C,c=P.2O,ls=c.2b,t=c.5V;A r=t&&t.14(D,P);R(A i in ls){if(!(i in ap)){ls[i].14(D,P)}}C r}},2P:B(6g,bT,i1){6g=6g||z.1W;A f=6g[bT];if(!f||!f.2b){A d=z.3i.i2();d.5V=f;d.2b=[];f=6g[bT]=d}C f.2b.Y(i1)},3J:B(i0,hZ,bS){A f=(i0||z.1W)[hZ];if(f&&f.2b&&bS--){63 f.2b[bS]}}};z.2c=B(M,pd,pc,pa,p9){A a=P,F=[],i=0;F.Y(z.1R(a[0])?L:a[i++],a[i++]);A a1=a[i+1];F.Y(z.1R(a1)||z.1Y(a1)?a[i++]:L,a[i++]);R(A l=a.G;i2){6e=z.7X(6e,P,2)}C D.5k(6e,6e)},ef:B(cb,4T){A 7Y=z.2p(cb,4T);if(P.G>2){7Y=z.7X(7Y,P,2)}C D.5k(7Y,L)},ed:B(cb,4T){A 7W=z.2p(cb,4T);if(P.G>2){7W=z.7X(7W,P,2)}C D.5k(L,7W)},5k:B(cb,eb){D.bM.Y([cb,eb]);if(D.2y>=0){D.7U()}C D},7U:B(){A bL=D.bM;A 4n=D.2y;A 1v=D.4R[4n];A 4S=D;A cb=L;1s((bL.G>0)&&(D.3M==0)){A f=bL.3a()[4n];if(!f){6c}1u{1v=f(1v);4n=((1v 1N 1O)?1:0);if(1v 1N z.30){cb=B(1v){4S.7V(1v);4S.3M--;if((4S.3M==0)&&(4S.2y>=0)){4S.7U()}};D.3M++}}1y(1G){1z.1K(1G);4n=1;1v=1G}}D.2y=4n;D.4R[4n]=1v;if((cb)&&(D.3M)){1v.9e(cb)}}})}if(!z.1h["z.X.2e"]){z.1h["z.X.2e"]=K;z.1Q("z.X.2e");z.5m=B(2e){1u{C 3u("("+2e+")")}1y(e){1z.1K(e);C 2e}};z.bK=B(2H){C("\\""+2H.2f(/(["\\\\])/g,"\\\\$1")+"\\"").2f(/[\\f]/g,"\\\\f").2f(/[\\b]/g,"\\\\b").2f(/[\\n]/g,"\\\\n").2f(/[\\t]/g,"\\\\t").2f(/[\\r]/g,"\\\\r")};z.hM="\\t";z.eq=B(it,4l,4P){4P=4P||"";A 4k=(4l?4P+z.hM:"");A 6b=(4l?"\\n":"");A 4Q=V(it);if(4Q=="1k"){C"1k"}I{if((4Q=="4J")||(4Q=="p1")){C it+""}I{if(it===L){C"L"}}}if(4Q=="3c"){C z.bK(it)}A 6d=P.2O;A 4m;if(V it.hL=="B"){4m=it.hL();if(it!==4m){C 6d(4m,4l,4k)}}if(V it.2e=="B"){4m=it.2e();if(it!==4m){C 6d(4m,4l,4k)}}if(z.2l(it)){A 1v=[];R(A i=0;i>=7R;t[x]=7R==4?17*c:c});t.a=1;C t};z.7P=B(a,M){A t=M||S z.1J();t.bz(2V(a[0]),2V(a[1]),2V(a[2]),2V(a[3]));if(2L(t.a)){t.a=1}C t.7Q()};z.hq=B(2H,M){A a=z.1J.hp[2H];C a&&z.7P(a,M)||z.ho(2H,M)||z.hn(2H,M)}}if(!z.1h["z.X"]){z.1h["z.X"]=K;z.1Q("z.X")}if(!z.1h["z.X.5Z"]){z.1h["z.X.5Z"]=K;z.1Q("z.X.5Z");(B(){A 1j=z.b2={2P:B(E,68,fp){if(!E){C}68=1j.4O(68);fp=1j.7G(68,fp);E.66(68,fp,U);C fp},3J:B(E,hm,hl){(E)&&(E.oF(1j.4O(hm),hl,U))},4O:B(1p){C(1p.2w(0,2)=="on"?1p.2w(2):1p)},7G:B(1p,fp){C(1p!="4b"?fp:B(e){C fp.2d(D,1j.4i(e,D))})},4i:B(H,oE){4w(H.Z){2X"4b":1j.7K(H);3f}C H},7K:B(H){H.oD=(H.3h?67.oC(H.3h):"")}};z.oB=B(H,hk){C 1j.4i(H,hk)};z.gY=B(H){H.7J();H.7I()};A 7O=z.3i;z.by=B(M,bx,hh,hg,hi){A hj=M&&(M.2t||M.oA||M.66);A bw=!hj?0:(!hi?1:2),l=[z.3i,1j,7O][bw];A h=l.2P(M,bx,z.2p(hh,hg));C[M,bx,h,bw]};z.bv=B(M,he,hd,hf){([z.3i,1j,7O][hf]).3J(M,he,hd)};z.5W={oz:8,gV:9,oy:12,ox:13,ow:16,ov:17,ou:18,gG:19,ot:20,os:27,or:32,b5:33,b4:34,gE:35,gF:36,b7:37,b9:38,b6:39,b8:40,gD:45,8S:46,oq:47,oo:91,om:92,ol:93,oj:96,oi:97,oh:98,og:99,oe:6D,od:oc,ob:oa,o9:o8,o7:o6,o5:o4,o3:bi,o2:o1,o0:nZ,nY:nX,nW:nV,nU:bk,gS:nT,gR:nS,gQ:nR,gP:nQ,gO:nP,gN:nO,gM:nN,gL:nM,gK:nL,gJ:nK,gI:nJ,gH:nI,nH:nG,nF:nE,nD:nC,gB:nB,gC:nA};if(z.1l){bf=B(e,5h){1u{C(e.3I=5h)}1y(e){C 0}};A 61=z.3i;if(!1o.nz){7O=61=z.gy={b3:[],2P:B(64,bu,hc){64=64||z.1W;A f=64[bu];if(!f||!f.2b){A d=z.gz();d.5V=f&&(7M.Y(f)-1);d.2b=[];f=64[bu]=d}C f.2b.Y(7M.Y(hc)-1)},3J:B(hb,ha,7N){A f=(hb||z.1W)[ha],l=f&&f.2b;if(f&&l&&7N--){63 7M[l[7N]];63 l[7N]}}};A 7M=61.b3}z.1x(1j,{2P:B(E,62,fp){if(!E){C}62=1j.4O(62);if(62=="h3"){A kd=E.bs;if(!kd||!kd.2b||!kd.h9){1j.2P(E,"bs",1j.h4);E.bs.h9=K}}C 61.2P(E,62,1j.7G(fp))},3J:B(E,h8,h7){61.3J(E,1j.4O(h8),h7)},4O:B(7L){C(7L.2w(0,2)!="on"?"on"+7L:7L)},ny:B(){},4i:B(H,4N){if(!H){A w=(4N)&&((4N.aD||4N.1q||4N).nx)||26;H=w.5Z}if(!H){C(H)}H.5V=H.br;H.bh=(4N||H.br);H.nw=H.nv;H.nu=H.nr;A bq=H.br,1e=(bq&&bq.aD)||1q;A bn=((z.1l<6)||(1e["aX"]=="aW"))?1e.3E:1e.5K;A bm=z.aB();H.nq=H.np+z.aH(bn.5I||0)-bm.x;H.nn=H.nm+(bn.5G||0)-bm.y;if(H.Z=="fk"){H.h6=H.nl}if(H.Z=="fj"){H.h6=H.nk}H.7I=1j.bc;H.7J=1j.ba;C 1j.h5(H)},h5:B(H){4w(H.Z){2X"4b":A c=("3h"in H?H.3h:H.3I);if(c==10){c=0;H.3I=13}I{if(c==13||c==27){c=0}I{if(c==3){c=99}}}H.3h=c;1j.7K(H);3f}C H},gZ:{bi:42,bk:47,h2:59,nj:43,ni:44,nh:45,ng:46,nf:47,60:96,h1:91,nb:92,na:93,h0:39},h4:B(H){A kp=H.bh.h3;if(!kp||!kp.2b){C}A k=H.3I;A bj=(k!=13)&&(k!=32)&&(k!=27)&&(k<48||k>90)&&(k<96||k>bk)&&(k60)&&(kh0);if(bj||H.5Y){A c=(bj?0:k);if(H.5Y){if(k==3||k==13){C}I{if(c>95&&c=65&&c<=90)){c+=32}I{c=1j.gZ[c]||c}}}}A 2x=1j.7H(H,{Z:"4b",2x:K,3h:c});kp.2d(H.bh,2x);H.bg=2x.bg;H.bd=2x.bd;bf(H,2x.3I)}},bc:B(){D.bg=K},ba:B(){D.n9=D.3I;if(D.5Y){bf(D,0)}D.bd=U}});z.gY=B(H){H=H||26.5Z;1j.bc.2d(H);1j.ba.2d(H)}}1j.7H=B(H,gX){A 2x=z.1x({},H,gX);1j.7K(2x);2x.7J=B(){H.7J()};2x.7I=B(){H.7I()};C 2x};if(z.2M){z.1x(1j,{4i:B(H,n8){4w(H.Z){2X"4b":A c=H.n7;if(c==3){c=99}c=((c<41)&&(!H.5X)?0:c);if((H.5Y)&&(!H.5X)&&(c>=65)&&(c<=90)){c+=32}C 1j.7H(H,{3h:c})}C H}})}if(z.3o){z.1x(1j,{4i:B(H,n6){4w(H.Z){2X"4b":A c=H.3h,s=H.5X,k=H.3I;k=k||gA[H.gW]||0;if(H.gW=="n5"){c=0}I{if((H.5Y)&&(c>0)&&(c<27)){c+=96}I{if(c==z.5W.gU){c=z.5W.gV;s=K}I{c=(c>=32&&c gh",E).1n(B(i){i.1c.7E=i.1c.7E.2f(/gk:[^;]*;/i,"")})}}I{A o="mh(mg="+(7D*6D)+")";E.1c.3T=o}if(E.gj.1M()=="gi"){z.1r("> gh",E).1n(B(i){i.1c.3T=o})}C 7D}:B(E,gg){C E.1c.2W=gg});A 5Q={3n:K,58:K,2g:K,5J:K};A gd=B(E,Z,5P){Z=Z.1M();if(5Q[Z]===K){C z.4g(E,5P)}I{if(5Q[Z]===U){C 5P}I{if((Z.T("mf")>=0)||(Z.T("md")>=0)||(Z.T("3n")>=0)||(Z.T("58")>=0)||(Z.T("5q")>=0)||(Z.T("mc")>=0)||(Z.T("ma")>=0)){5Q[Z]=K;C z.4g(E,5P)}I{5Q[Z]=U;C 5P}}}};z.1c=B(E,5O,aT){A n=z.1D(E),F=P.G,op=(5O=="2W");if(F==3){C op?z.gf(n,aT):n.1c[5O]=aT}if(F==2&&op){C z.ge(n)}A s=z.3F(n);C(F==1)?s:gd(n,5O,s[5O])};z.7A=B(n,gc){A s=gc||1E(n),px=z.4g,l=px(n,s.m9),t=px(n,s.m8);C{l:l,t:t,w:l+px(n,s.m7),h:t+px(n,s.m6)}};z.5N=B(n,gb){A ne="7C",px=z.4g,s=gb||1E(n),bl=(s.m5!=ne?px(n,s.m4):0),bt=(s.m3!=ne?px(n,s.m2):0);C{l:bl,t:bt,w:bl+(s.m1!=ne?px(n,s.m0):0),h:bt+(s.lZ!=ne?px(n,s.lY):0)}};z.aN=B(n,ga){A s=ga||1E(n),p=z.7A(n,s),b=z.5N(n,s);C{l:p.l+b.l,t:p.t+b.t,w:p.w+b.w,h:p.h+b.h}};z.aM=B(n,g9){A s=g9||1E(n),px=z.4g,l=px(n,s.lX),t=px(n,s.lW),r=px(n,s.lV),b=px(n,s.lU);if(z.3o&&(s.ax!="fU")){r=l}C{l:l,t:t,w:l+r,h:t+b}};z.au=B(E,g8){A s=g8||1E(E),me=z.aM(E,s);A l=E.fT-me.l,t=E.fS-me.t;if(z.7B){A aS=2k(s.2g),aR=2k(s.5J);if(!2L(aS)&&!2L(aR)){l=aS,t=aR}I{A p=E.1L;if(p&&p.1c){A aQ=1E(p);if(aQ.lT!="lS"){A be=z.5N(p,aQ);l+=be.l,t+=be.t}}}}I{if(z.2M){A p=E.1L;if(p){A be=z.5N(p);l-=be.l,t-=be.t}}}C{l:l,t:t,w:E.6v+me.w,h:E.8D+me.h}};z.aK=B(E,g7){A s=g7||1E(E),pe=z.7A(E,s),be=z.5N(E,s),w=E.aF,h;if(!w){w=E.6v,h=E.8D}I{h=E.lR,be.w=be.h=0}if(z.2M){pe.l+=be.l;pe.t+=be.t}C{l:pe.l,t:pe.t,w:w-pe.w-be.w,h:h-pe.h-be.h}};z.lQ=B(E,g6){A s=g6||1E(E),pe=z.7A(E,s),cb=z.aK(E,s);C{l:cb.l-pe.l,t:cb.t-pe.t,w:cb.w+pe.w,h:cb.h+pe.h}};z.aL=B(E,l,t,w,h,u){u=u||"px";4G(E.1c){if(!2L(l)){2g=l+u}if(!2L(t)){5J=t+u}if(w>=0){3n=w+u}if(h>=0){58=h+u}}};z.aO=B(E){A n=E.5w;C(z.aP=="g5-3G")||(n=="lP")||(n=="lO")};z.fX=B(E,7z,7y,g4){A bb=z.aO(E);if(bb){A pb=z.aN(E,g4);if(7z>=0){7z+=pb.w}if(7y>=0){7y+=pb.h}}z.aL(E,g3,g3,7z,7y)};z.fY=B(E,g1,g0,5M,5L,g2){A s=g2||z.3F(E);A bb=z.aO(E),pb=bb?fZ:z.aN(E,s),mb=z.aM(E,s);if(5M>=0){5M=2Y.5q(5M-pb.w-mb.w,0)}if(5L>=0){5L=2Y.5q(5L-pb.h-mb.h,0)}z.aL(E,g1,g0,5M,5L)};A fZ={l:0,t:0,w:0,h:0};z.lN=B(E,3G){A n=z.1D(E),s=1E(n),b=3G;C!b?z.au(n,s):z.fY(n,b.l,b.t,b.w,b.h,s)};z.lM=B(E,3G){A n=z.1D(E),s=1E(n),b=3G;C!b?z.aK(n,s):z.fX(n,b.w,b.h,s)};A 5H=B(E,1a){if(!(E=(E||0).1L)){C 0}A 1U,aJ=0,2h=z.3E();1s(E&&E.1c){if(1E(E).ax=="lL"){C 0}1U=E[1a];if(1U){aJ+=1U-0;if(E==2h){3f}}E=E.1L}C aJ};z.fQ=B(){A 2h=z.3E();A 3g=z.1W;A de=z.1e.5K;C{y:(3g.lK||de.5G||2h.5G||0),x:(3g.lJ||z.aH(de.5I)||2h.5I||0)}};z.aG=B(){C V z.aI=="1k"?(z.aI=z.3F(z.3E()).lI=="lH"):z.aI};z.aB=B(){A de=z.1e.5K;if(z.1l>=7){C{x:de.aC().2g,y:de.aC().5J}}I{C{x:z.aG()||26.am==26?de.fW:de.6v-de.aF-de.fW,y:de.lG}}};z.aH=B(aE){if(z.1l&&!z.aG()){A de=z.1e.5K;C aE+de.aF-de.lF}C aE};z.fP=B(E,aw){A ay=E.aD;A J={x:0,y:0};A 7w=U;A db=z.3E();if(z.1l){A aA=E.aC();A az=z.aB();J.x=aA.2g-az.x;J.y=aA.5J-az.y}I{if(ay["fV"]){A bo=ay.fV(E);J.x=bo.x-5H(E,"5I");J.y=bo.y-5H(E,"5G")}I{if(E["fR"]){7w=K;A 7x;if(z.3o&&(1E(E).ax=="fU")&&(E.1L==db)){7x=db}I{7x=db.1L}if(E.1L!=db){A nd=E;if(z.2M){nd=db}J.x-=5H(nd,"5I");J.y-=5H(nd,"5G")}A 4f=E;do{A n=4f["fT"];if(!z.2M||n>0){J.x+=2L(n)?0:n}A m=4f["fS"];J.y+=2L(m)?0:m;4f=4f.fR}1s((4f!=7x)&&4f)}I{if(E["x"]&&E["y"]){J.x+=2L(E.x)?0:E.x;J.y+=2L(E.y)?0:E.y}}}}if(7w||aw){A av=z.fQ();A m=7w?(!aw?-1:0):1;J.y+=m*av.y;J.x+=m*av.x}C J};z.af=B(E,fO){A n=z.1D(E),s=1E(n),mb=z.au(n,s);A at=z.fP(n,fO);mb.x=at.x;mb.y=at.y;C mb}})();z.fL=B(E,fN){C((" "+E.3A+" ").T(" "+fN+" ")>=0)};z.7s=B(E,ar){A 7v=E.3A;if((" "+7v+" ").T(" "+ar+" ")<0){E.3A=7v+(7v?" ":"")+ar}};z.7r=B(E,fM){A t=z.7g((" "+E.3A+" ").2f(" "+fM+" "," "));if(E.3A!=t){E.3A=t}};z.lE=B(E,aq,7u){if(V 7u=="1k"){7u=!z.fL(E,aq)}z[7u?"7s":"7r"](E,aq)}}if(!z.1h["z.X.1H"]){z.1h["z.X.1H"]=K;z.1Q("z.X.1H");(B(){A d=z;z.1H=B(){A F=P;if((F.G==1)&&(V F[0]=="4J")){D.G=eK(F[0])}I{if(F.G){d.1n(F,B(i){D.Y(i)},D)}}};z.1H.1C=S 4e;if(d.1l){A fK=B(al){C("A a2 = am."+al+"; "+"A ap = 4e.1C; "+"A ao = a2.1C; "+"R(A x in ao){ ap[x] = ao[x]; } "+"am."+al+" = 4e; ")};A fI=fK("z.1H");A aj=26.lD();aj.1q.fJ(""+fI+"");aj.lC(1,1,1,1)}z.4M(z.1H,{T:B(fH,fG){C d.T(D,fH,fG)},31:B(lB,lA){A aa=d.4d(P);aa.ae(D);C d.31.14(d,aa)},ah:B(fF,fE){C d.ah(D,fF,fE)},ag:B(fD,fC){C d.ag(D,fD,fC)},1n:B(fB,fA){d.1n(D,fB,fA);C D},23:B(7t,M){C d.23(D,7t,M,d.1H)},af:B(){C d.23(D,d.af)},1c:B(lz,ly){A aa=d.4d(P);aa.ae(D[0]);A s=d.1c.14(d,aa);C(P.G>1)?D:s},lx:B(lw,lv){A aa=d.4d(P);aa.ae(L);A s=D.23(B(i){aa[0]=i;C d.1c.14(d,aa)});C(P.G>1)?D:s},7s:B(fz){C D.1n(B(i){z.7s(i,fz)})},7r:B(fy){C D.1n(B(i){z.7r(i,fy)})},5E:B(fw,7q){A 1m=d.1r(fw)[0];7q=7q||"72";R(A x=0;x=0){if(i[x]<1d){1d=i[x]}}}C(1d<0)?ql:1d};A 6X=B(7l){A i=2I(7l);if(i[0]!=-1){C 7l.21(i[0]+1,a0(7l,1))}I{C""}};A 5r=B(7k){A 5D;A i=2I(7k);if((i[0]==0)||(i[1]==0)){5D=0}I{5D=a0(7k,0)}C((5D>0)?7k.3b(0,5D).1M():"*")};A fg=B(Q){A J=-1;R(A x=0;x=0){if((1S>J)||(J==-1)){J=1S}}}C J};A 9H=B(7i){A i=2I(7i);if(-1==i[1]){C""}A di=i[1]+1;A 7j=fg(i.2w(2));if(di<7j){C 7i.21(di,7j)}I{if(-1==7j){C 7i.3b(di)}I{C""}}};A f3=[{1i:"|=",1f:B(15,fe){C"[5z(3U(\' \',@"+15+",\' \'), \' "+fe+"-\')]"}},{1i:"~=",1f:B(15,fd){C"[5z(3U(\' \',@"+15+",\' \'), \' "+fd+" \')]"}},{1i:"^=",1f:B(15,fb){C"[li-4G(@"+15+", \'"+fb+"\')]"}},{1i:"*=",1f:B(15,fa){C"[5z(@"+15+", \'"+fa+"\')]"}},{1i:"$=",1f:B(15,9Z){C"[21(@"+15+", 3c-G(@"+15+")-"+(9Z.G-1)+")=\'"+9Z+"\']"}},{1i:"!=",1f:B(15,f9){C"[3O(@"+15+"=\'"+f9+"\')]"}},{1i:"=",1f:B(15,f8){C"[@"+15+"=\'"+f8+"\']"}}];A 9C=B(9Y,3Z,f7,f6){A 49;A i=2I(3Z);if(i[2]>=0){A 4L=3Z.T("]",i[2]);A 29=3Z.21(i[2]+1,4L);1s(29&&29.G){if(29.2s(0)=="@"){29=29.2w(1)}49=L;R(A x=0;x<9Y.G;x++){A 1S=9Y[x];A 7h=29.T(1S.1i);if(7h>=0){A 15=29.21(0,7h);A 4a=29.21(7h+1S.1i.G);if((4a.2s(0)=="\\"")||(4a.2s(0)=="\'")){4a=4a.21(1,4a.G-1)}49=1S.1f(d.7g(15),d.7g(4a));3f}}if((!49)&&(29.G)){49=f7(29)}if(49){f6(49)}29=L;A 7f=3Z.T("[",4L);if(0<=7f){4L=3Z.T("]",7f);if(0<=4L){29=3Z.21(7f+1,4L)}}}}};A f0=B(f5){A 4K=".";A 7e=f5.1A(" ");1s(7e.G){A 2K=7e.3a();A 7d;if(2K==">"){7d="/";2K=7e.3a()}I{7d="//"}A f4=5r(2K);4K+=7d+f4;A id=6X(2K);if(id.G){4K+="[@id=\'"+id+"\'][1]"}A cn=9H(2K);if(cn.G){A 9X=" ";if(cn.2s(cn.G-1)=="*"){9X="";cn=cn.3b(0,cn.G-1)}4K+="[5z(3U(\' \',@9P,\' \'), \' "+cn+9X+"\')]"}9C(f3,2K,B(f2){C"[@"+f2+"]"},B(f1){4K+=f1})}C 4K};A 7a={};A eC=B(28){if(7a[28]){C 7a[28]}A 1e=d.1e;A 9W=f0(28);A 4H=B(9V){A J=[];A 7b;1u{7b=1e.9x(9W,9V,L,lh.lg,L)}1y(e){1z.1K("lf in le:",9W,"lc:",9V);1z.1K(e)}A 7c=7b.eZ();1s(7c){J.Y(7c);7c=7b.eZ()}C J};C 7a[28]=4H};A 5x={};A 9B={};A 3y=B(79,78){if(!79){C 78}if(!78){C 79}C B(){C 79.14(26,P)&&78.14(26,P)}};A 75=B(9U,3Y,5B,2J){A 2v=2J+1;A 76=(3Y.G==2v);A 2K=3Y[2J];if(2K==">"){A 77=9U.3W;if(!77.G){C}2v++;76=(3Y.G==2v);A 4H=6O(3Y[2J+1]);R(A x=0,11;x<77.G,11=77[x];x++){if(4H(11)){if(76){5B.Y(11)}I{75(11,3Y,5B,2v)}}}}A 5C=6U(2K)(9U);if(76){1s(5C.G){5B.Y(5C.3a())}}I{1s(5C.G){75(5C.3a(),3Y,5B,2v)}}};A eE=B(9T,eY){A J=[];A x=9T.G-1,11;1s(11=9T[x--]){75(11,eY,J,0)}C J};A 6O=B(3D){if(5x[3D]){C 5x[3D]}A ff=L;A 9S=5r(3D);if(9S!="*"){ff=3y(ff,B(N){C((N.2t==1)&&(9S==N.5w.1M()))})}A 9R=6X(3D);if(9R.G){ff=3y(ff,B(N){C((N.2t==1)&&(N.id==9R))})}if(2Y.5q.14(D,2I(3D).2w(1))>=0){ff=3y(ff,9z(3D))}C 5x[3D]=ff};A 5y=B(E){A pn=E.1L;A 9Q=pn.3W;A 2v=-1;A 3C=pn.5A;if(!3C){C 2v}A ci=E["eW"];A cl=pn["eX"];if(((V cl=="4J")&&(cl!=9Q.G))||(V ci!="4J")){pn["eX"]=9Q.G;A 2J=1;do{if(3C===E){2v=2J}if(3C.2t==1){3C["eW"]=2J;2J++}3C=3C.71}1s(3C)}I{2v=ci}C 2v};A lb=0;A 3X=B(N,15){A 74="";if(15=="9P"){C N.3A||74}if(15=="R"){C N.la||74}C N.5t(15,2)||74};A eH=[{1i:"|=",1f:B(15,9O){A eV=" "+9O+"-";C B(N){A ea=" "+(N.5t(15,2)||"");C((ea==9O)||(ea.T(eV)==0))}}},{1i:"^=",1f:B(15,eU){C B(N){C(3X(N,15).T(eU)==0)}}},{1i:"*=",1f:B(15,eT){C B(N){C(3X(N,15).T(eT)>=0)}}},{1i:"~=",1f:B(15,eS){A 9N=" "+eS+" ";C B(N){A ea=" "+3X(N,15)+" ";C(ea.T(9N)>=0)}}},{1i:"$=",1f:B(15,73){A 9N=" "+73;C B(N){A ea=" "+3X(N,15);C(ea.31(73)==(ea.G-73.G))}}},{1i:"!=",1f:B(15,eR){C B(N){C(3X(N,15)!=eR)}}},{1i:"=",1f:B(15,eQ){C B(N){C(3X(N,15)==eQ)}}}];A 9E=[{1i:"9M-9K",1f:B(1p,l9){C B(N){if(N.2t!=1){C U}A fc=N.eP;1s(fc&&(fc.2t!=1)){fc=fc.eP}C(!fc)}}},{1i:"72-9K",1f:B(1p,l8){C B(N){if(N.2t!=1){C U}A nc=N.71;1s(nc&&(nc.2t!=1)){nc=nc.71}C(!nc)}}},{1i:"l7",1f:B(1p,l6){C B(N){A cn=N.3W;A eO=N.3W.G;R(A x=eO-1;x>=0;x--){A nt=cn[x].2t;if((nt==1)||(nt==3)){C U}}C K}}},{1i:"5z",1f:B(1p,eN){C B(N){C(N.9L.T(eN)>=0)}}},{1i:"3O",1f:B(1p,eM){A eL=6O(eM);C B(N){C(!eL(N))}}},{1i:"l5-9K",1f:B(1p,2u){A pi=eK;if(2u=="l4"){C B(N){C(((5y(N))%2)==1)}}I{if((2u=="2n")||(2u=="l3")){C B(N){C((5y(N)%2)==0)}}I{if(2u.T("l2+")==0){A 70=pi(2u.3b(3));C B(N){C(N.1L.3W[70-1]===N)}}I{if((2u.T("n+")>0)&&(2u.G>3)){A 9J=2u.1A("n+",2);A eJ=pi(9J[0]);A 2J=pi(9J[1]);C B(N){C((5y(N)%eJ)==2J)}}I{if(2u.T("n")==-1){A 70=pi(2u);C B(N){C(5y(N)==70)}}}}}}}}];A 9z=B(3e){A 9I=(9B[3e]||5x[3e]);if(9I){C 9I}A ff=L;A i=2I(3e);if(i[0]>=0){A 24=5r(3e);if(24!="*"){ff=3y(ff,B(N){C(N.5w.1M()==24)})}}A 5u;A 3B=9H(3e);if(3B.G){A 9F=3B.2s(3B.G-1)=="*";if(9F){3B=3B.3b(0,3B.G-1)}A re=S 9G("(?:^|\\\\s)"+3B+(9F?".*":"")+"(?:\\\\s|$)");ff=3y(ff,B(N){C re.6Z(N.3A)})}if(i[3]>=0){A 3z=3e.3b(i[3]+1);A 9D="";A 5v=3z.T("(");A 6Y=3z.31(")");if((0<=5v)&&(0<=6Y)&&(6Y>5v)){9D=3z.21(5v+1,6Y);3z=3z.3b(0,5v)}5u=L;R(A x=0;x<9E.G;x++){A 1S=9E[x];if(1S.1i==3z){5u=1S.1f(3z,9D);3f}}if(5u){ff=3y(ff,5u)}}A eG=(d.1l)?B(5s){A eI=5s.1M();C B(N){C N[5s]||N[eI]}}:B(5s){C B(N){C(N&&N.5t&&N.l1(5s))}};9C(eH,3e,eG,B(eF){ff=3y(ff,eF)});if(!ff){ff=B(){C K}}C 9B[3e]=ff};A 6W={};A 6U=B(3d,1B){A 9A=6W[3d];if(9A){C 9A}A i=2I(3d);A id=6X(3d);if(i[0]==0){C 6W[3d]=B(1B){C[d.1D(id)]}}A 9y=9z(3d);A 5p;if(i[0]>=0){5p=B(1B){A 11=d.1D(id);if(9y(11)){C[11]}}}I{A 3V;A 24=5r(3d);if(2Y.5q.14(D,2I(3d))==-1){5p=B(1B){A J=[];A 11,x=0,3V=1B.4I(24);1s(11=3V[x++]){J.Y(11)}C J}}I{5p=B(1B){A J=[];A 11,x=0,3V=1B.4I(24);1s(11=3V[x++]){if(9y(11)){J.Y(11)}}C J}}}C 6W[3d]=5p};A l0={};A 5o={">":B(1B){A J=[];A 11,x=0,3V=1B.3W;1s(11=3V[x++]){if(11.2t==1){J.Y(11)}}C J}};A 9w=B(6V){if(0>6V.T(" ")){C 6U(6V)}A eD=B(1B){A 6S=6V.1A(" ");A 6T;if(6S[0]==">"){6T=[1B]}I{6T=6U(6S.3a())(1B)}C eE(6T,6S)};C eD};A 9v=((1q["9x"]&&!d.3o)?B(3x){A 6R=3x.1A(" ");if((1q["9x"])&&(3x.T(":")==-1)&&((K))){if(((6R.G>2)&&(3x.T(">")==-1))||(6R.G>3)||(3x.T("[")>=0)||((1==6R.G)&&(0<=3x.T(".")))){C eC(3x)}}C 9w(3x)}:9w);A ey=B(3w){if(5o[3w]){C 5o[3w]}if(0>3w.T(",")){C 5o[3w]=9v(3w)}I{A eB=3w.1A(/\\s*,\\s*/);A 4H=B(1B){A eA=0;A J=[];A 6Q;1s(6Q=eB[eA++]){J=J.3U(9v(6Q,6Q.T(" "))(1B))}C J};C 5o[3w]=4H}};A 5n=0;A ez=B(Q){A J=S d.1H();if(!Q){C J}if(Q[0]){J.Y(Q[0])}if(Q.G<2){C J}5n++;Q[0]["9u"]=5n;R(A x=1,11;11=Q[x];x++){if(Q[x]["9u"]!=5n){J.Y(11)}11["9u"]=5n}C J};d.1r=B(6P,1B){if(V 6P!="3c"){C S d.1H(6P)}if(V 1B=="3c"){1B=d.1D(1B)}C ez(ey(6P)(1B||d.1e))};d.9t=B(ex,9s){A 9r=S d.1H();A ff=(9s)?6O(9s):B(){C K};R(A x=0,11;11=ex[x];x++){if(ff(11)){9r.Y(11)}}C 9r}})()}if(!z.1h["z.X.1b"]){z.1h["z.X.1b"]=K;z.1Q("z.X.1b");z.6K=B(ew){A J={};A iq="kZ[Z!=9q][Z!=kY][Z!=et][Z!=kX][Z!=kW], kV, kU";z.1r(iq,ew).3T(B(E){C(!E.kT)}).1n(B(1m){A 3v=1m.1p;A Z=(1m.Z||"").1M();if((Z=="kS")||(Z=="kR")){if(1m.kQ){J[3v]=1m.1Z}}I{if(1m.kP){A ev=J[3v]=[];z.1r("kO[kN]",1m).1n(B(eu){ev.Y(eu.1Z)})}I{J[3v]=1m.1Z;if(Z=="et"){J[3v+".x"]=J[3v+".y"]=J[3v].x=J[3v].y=0}}}});C J};z.9h=B(23){A ec=kM;A J="";A es={};R(A x in 23){if(23[x]!=es[x]){if(z.2l(23[x])){R(A y=0;y<23[x].G;y++){J+=ec(x)+"="+ec(23[x][y])+"&"}}I{J+=ec(x)+"="+ec(23[x])+"&"}}}if((J.G)&&(J.2s(J.G-1)=="&")){J=J.3b(0,J.G-1)}C J};z.kL=B(er){C z.9h(z.6K(er))};z.kK=B(ep){C z.eq(z.6K(ep))};z.kJ=B(2H){A J={};A qp=2H.1A("&");A dc=kI;z.1n(qp,B(1m){if(1m.G){A 9p=1m.1A("=");A 1p=dc(9p.3a());A 1U=dc(9p.22("="));if(z.1R(J[1p])){J[1p]=[J[1p]]}if(z.2l(J[1p])){J[1p].Y(1U)}I{J[1p]=1U}}});C J};z.e1=U;z.e6={"9g":B(1b){C 1b.2G},"2e":B(1b){if(!1o.eo){1z.1K("kH kG kF a kE of 9g/2e-6M-9m"+" 4F kD kC kB kA 4G en kz"+" (ky 1o.eo=K 4F kx kw D kv)")}C z.5m(1b.2G)},"2e-6M-ku":B(1b){A 6N=1b.2G;A 9o=6N.T("/*");A 9n=6N.31("*/");if((9o==-1)||(9n==-1)){C z.5m(1b.2G)}C z.5m(6N.21(9o+2,9n))},"2e-6M-9m":B(1b){A 6L=1b.2G;A 9l=6L.T("/*");A 9k=6L.31("*/");if((9l==-1)||(9k==-1)){1z.1K("kt en ks\'t 6M 9m!");C""}C z.5m(6L.21(9l+2,9k))},"kr":B(1b){C z.3u(1b.2G)},"kq":B(1b){if(z.1l&&!1b.el){z.1n(["ko","em","kn","km"],B(i){1u{A 1e=S 9j(kl[i]+".kk");1e.kj=U;1e.ki(1b.2G);C 1e}1y(e){}})}I{C 1b.el}}};(B(){z.e5=B(F,ej,ei,eh){A 2F={};2F.F=F;A 6J=L;if(F.3R){A 3R=z.1D(F.3R);A 9i=3R.kh("kg");2F.2E=F.2E||(9i?9i.1Z:L);6J=z.6K(3R)}I{2F.2E=F.2E}A 5l=[{}];if(6J){5l.Y(6J)}if(F.5g){5l.Y(F.5g)}if(F.ek){5l.Y({"z.ek":S 5d().8O()})}2F.1r=z.9h(z.1x.14(L,5l));2F.9d=F.9d||"9g";A d=S z.30(ej);d.5k(ei,B(eg){C eh(eg,d)});A ld=F.4E;if(ld&&z.1Y(ld)){d.ef(B(ee){C ld.2d(F,ee,2F)})}A 1G=F.9f;if(1G&&z.1Y(1G)){d.ed(B(e9){C 1G.2d(F,e9,2F)})}A 6I=F.kf;if(6I&&z.1Y(6I)){d.9e(B(e8){C 6I.2d(F,e8,2F)})}d.1F=2F;C d};A e4=B(O){O.e0=K;A 1b=O.1F.1b;if(V 1b.e7=="B"){1b.e7()}};A e3=B(O){C z.e6[O.1F.9d](O.1F.1b)};A e2=B(9c,O){1z.1K(9c);C 9c};A 3Q=B(F){A O=z.e5(F,e4,e3,e2);O.1F.1b=z.9b(O.1F.F);C O};A 5j=L;A 3t=[];A 94=B(){A dZ=(S 5d()).dU();if(!z.e1){z.1n(3t,B(4D,6H){if(!4D){C}A O=4D.O;1u{if(!O||O.e0||!4D.dT(O)){3t.3S(6H,1);C}if(4D.dR(O)){3t.3S(6H,1);4D.dP(O)}I{if(O.9a){if(O.9a+(O.1F.F.6G||0)0){5c(z.2p(D,B(){D.5b(L,8R)}),d);C D}D.4A=S 5d().8O();if(D.2Z){D.4A-=D.8Q*D.2o}D.8N=D.4A+D.8Q;D.2D=K;D.2Z=U;A 8P=D.2C.4x(D.2o);if(!D.2o){if(!D.4y){D.4y=D.4z}D.3q("dt",[8P])}D.3q("ds",[8P]);D.8M();C D},jS:B(){5e(D.3r);if(!D.2D){C D}D.2Z=K;D.3q("dr",[D.2C.4x(D.2o)]);C D},jR:B(dq,dp){5e(D.3r);D.2D=D.2Z=K;D.2o=dq*6D;if(dp){D.5b()}C D},jQ:B(dn){if(!D.3r){C}5e(D.3r);if(dn){D.2o=1}D.3q("dm",[D.2C.4x(D.2o)]);D.2D=D.2Z=U;C D},3N:B(){if(D.2D){C D.2Z?"3M":"jP"}C"jO"},8M:B(){5e(D.3r);if(D.2D){A dl=S 5d().8O();A 2q=(dl-D.4A)/(D.8N-D.4A);if(2q>=1){2q=1}D.2o=2q;if(D.5a){2q=D.5a(2q)}D.3q("8B",[D.2C.4x(2q)]);if(2q<1){D.3r=5c(z.2p(D,"8M"),D.dj)}I{D.2D=U;if(D.4z>0){D.4z--;D.5b(L,K)}I{if(D.4z==-1){D.5b(L,K)}I{if(D.4y){D.4z=D.4y;D.4y=0}}}D.2o=0;D.3q("dh")}}C D}});(B(){A df=B(E){if(z.1l){A ns=E.1c;if(!ns.8L.G&&z.1c(E,"8L")=="dg"){ns.8L="1"}if(!ns.3n.G&&z.1c(E,"3n")=="8K"){ns.3n="8K"}}};z.6C=B(F){if(V F.1d=="1k"){2m S 1O("z.6C jN an 1d 1Z")}F.E=z.1D(F.E);A 3p=z.1x({6w:{}},F);A 8J=(3p.6w.2W={});8J.1w=(V 3p.1w=="1k")?B(){C 2V(z.1c(3p.E,"2W"))}:3p.1w;8J.1d=3p.1d;A 2U=z.6y(3p);z.2c(2U,"6x",L,B(){df(3p.E)});C 2U};z.8I=B(F){C z.6C(z.1x({1d:1},F))};z.8H=B(F){C z.6C(z.1x({1d:0},F))};if(z.6B&&!z.3o){z.8E=B(n){C 2k("0.5")+((2Y.da((n+2k("1.5"))*2Y.d9))/2)}}I{z.8E=B(n){C 0.5+((2Y.da((n+1.5)*2Y.d9))/2)}}A d4=B(6A){D.8G=6A;R(A p in 6A){A 1a=6A[p];if(1a.1w 1N z.1J){1a.d7=S z.1J()}}D.4x=B(r){A J={};R(A p in D.8G){A 1a=D.8G[p];A 6z=L;if(1a.1w 1N z.1J){6z=z.d8(1a.1w,1a.1d,r,1a.d7).8F()}I{if(!z.2l(1a.1w)){6z=((1a.1d-1a.1w)*r)+1a.1w+(p!="2W"?1a.jM||"px":"")}}J[p]=6z}C J}};z.6y=B(F){F.E=z.1D(F.E);if(!F.5a){F.5a=z.8E}A 2U=S z.d6(F);z.2c(2U,"6x",2U,B(){A pm={};R(A p in D.6w){A 1a=pm[p]=z.1x({},D.6w[p]);if(z.1Y(1a.1w)){1a.1w=1a.1w()}if(z.1Y(1a.1d)){1a.1d=1a.1d()}A d5=(p.1M().T("jL")>=0);B 8C(E,p){4w(p){2X"58":C E.8D;2X"3n":C E.6v}A v=z.1c(E,p);C(p=="2W")?2V(v):2k(v)};if(V 1a.1d=="1k"){1a.1d=8C(D.E,p)}I{if(V 1a.1w=="1k"){1a.1w=8C(D.E,p)}}if(d5){1a.1w=S z.1J(1a.1w);1a.1d=S z.1J(1a.1d)}I{1a.1w=(p=="2W")?2V(1a.1w):2k(1a.1w)}}D.2C=S d4(pm)});z.2c(2U,"8B",2U,B(8A){R(A s in 8A){z.1c(D.E,s,8A[s])}});C 2U}})()}',62,1711,'|||||||||||||||||||||||||||||||||||dojo|var|function|return|this|node|args|length|evt|else|ret|true|null|obj|elem|dfd|arguments|arr|for|new|indexOf|false|typeof||_base|push|type||te|||apply|attr|||||prop|xhr|style|end|doc|match|uri|_hasResource|key|del|undefined|isIE|item|forEach|djConfig|name|document|query|while|_66|try|res|start|mixin|catch|console|split|root|prototype|byId|gcs|ioArgs|err|NodeList|_p|Color|debug|parentNode|toLowerCase|instanceof|Error|constructor|provide|isString|ta|255|val|_a|global|_69|isFunction|value||substring|join|map|tn||window||path|_343|_220|_listeners|connect|call|json|replace|left|_b|toString|128|parseFloat|isArray|throw||_percent|hitch|step|declare|charAt|nodeType|_3c3|nidx|slice|faux|fired|_c4|_7e|loc|curve|_active|url|_44c|responseText|str|_312|idx|tqp|isNaN|isOpera|_22d|callee|add|_18b|_f8|_e2|_41|anim|Number|opacity|case|Math|_paused|Deferred|lastIndexOf|||||||||shift|substr|string|_3e7|_3ce|break|_w|charCode|_listener|_d5|_c5|authority|_49|width|isSafari|_49e|fire|_timer|_47b|_465|eval|_in|_40c|_409|_362|_3d9|className|_3d5|_386|_37a|body|getComputedStyle|box|_221|keyCode|remove|_8d|_46|paused|status|not|_478|_461|form|splice|filter|concat|tret|childNodes|_38b|_367|_33d||||||||||_340|_348|keypress|appendChild|_toArray|Array|_2b0|_toPixelValue|ref|_fixEvent|_19f|_14c|_14a|_150|_141|declaredClass|_d4|_99|_Url|_83|scheme|_67|_3d|switch|getValue|_startRepeatCount|repeat|_startTime|_47e|cancel|tif|load|to|with|tf|getElementsByTagName|number|_34c|_342|extend|_1e3|_normalizeEventName|_14b|_14e|results|self|cbfn|_f9|_d8|_b2|src|_88|dav||baseUrl|fragment|_loadedModules|_44|_43|_loaders|mll|height||easing|play|setTimeout|Date|clearTimeout|hdr|content|code|errback|_464|addCallbacks|_450|fromJson|_413|_3fc|_3ee|max|_31e|cond|getAttribute|_3d4|obi|tagName|_360|_381|contains|firstChild|_368|_372|_320|place|_2fa|scrollTop|_299|scrollLeft|top|documentElement|_288|_287|_getBorderExtents|_23f|_23d|_239|_218|_216|_211|eles|target|keys|shiftKey|ctrlKey|event|192|iel|_1db|delete|_1cf||addEventListener|String|_1af|_157|array|_14d|continue|_14f|_137|_11f|_106|_findMethod|has|_delegate|_dc|_d3|loaded|_9a|_loadInit|_inFlightCount|getObject|tv|_4f|_postLoad|_2d|offsetWidth|properties|beforeBegin|animateProperty|_4ad|_4a6|isKhtml|_fade|100|headers|readyState|timeout|_469|_457|_44d|formToObject|_441|comment|_43d|_36f|_419|tp|_40a|_406|_407|_373|_403|_3e6|_31b|cbi|test|_3c7|nextSibling|last|_3a1|_38e|_365|_36b|ecn|_364|_363|_356|_35e|_35f|_34f|_34d|_349|trim|tci|_328|_32b|_31f|_31c|_anim|_300|_2ff|_2f5|_2e7|removeClass|addClass|func|_2c4|cls|_2a9|_2ae|_280|_27f|_getPadExtents|isMoz|none|_233|cssText|_214|_fixCallback|_synthesizeEvent|stopPropagation|preventDefault|_setKeyChar|_1e1|ieh|_1d7|_1be|colorFromArray|sanitize|bits|rgb|_156|_fire|_resback|_13d|partial|_13a|silentlyCancelled|_topics|_127|_f1|_f0|superclass|_ec|_e3|mct|setObject|_bf|_b3|object|require|_92|_khtmlTimer|location|XMLHTTP|locale|dua|_71|_modulePrefixes|_55|_loadModule|_51|_50|_4e|pop|_3f|_callLoaded|_unloaders|_loadNotifying|_loadedUrls|_27|_24|_1d|_5|_4b7|onAnimate|getStyle|offsetHeight|_defaultEasing|toCss|_properties|fadeOut|fadeIn|_49f|auto|zoom|_cycle|_endTime|valueOf|_494|duration|_492|DELETE|_ioAddQueryToUrl|putData|contentType|password|user|_isDocumentOk|application|||||_466||||||startTime|_xhrObj|_45f|handleAs|addBoth|error|text|objectToQuery|_44f|ActiveXObject|_443|_442|filtered|_43f|_43e|_437|file|tnl|_41c|_filterQueryResult|_zipIdx|_408|_402|evaluate|_3ed|_380|fHit|_361|_33b|_3da|_3ab|_3d6|RegExp|_327|_3cf|_3c9|child|innerHTML|first|tval|_391|class|pnc|_37e|_37c|_375|_366|_35c|_35a|_353|_33c|_336|_314|||_315|_oe|_307|_309|cloneNode|after|createElement||_2f8|_2ef|_2ee|unshift|coords|some|every||_2cb|script|_2c9|parent||a2p||_2c3|_2bd||abs|_getMarginBox|_2b3|_2a6|position|_2a7|_2ac|_2ab|_getIeDocumentElementOffset|getBoundingClientRect|ownerDocument|_2a3|clientWidth|_isBodyLtr|_fixIeBiDiScrollLeft|_bodyLtr|_29d|_getContentBox|_setBox|_getMarginExtents|_getPadBorderExtents|_usesBorderBox|boxModel|pcs|st|sl|_240|runtimeStyle|_dcm|BackCompat|compatMode|default|_21b|_d|html|_event_listener|handlers|PAGE_DOWN|PAGE_UP|RIGHT_ARROW|LEFT_ARROW|DOWN_ARROW|UP_ARROW|_preventDefault||_stopPropagation|returnValue||_trySetKeyCode|cancelBubble|currentTarget|106|_1ee|111||_1e8|_1e7|||se|srcElement|onkeydown||_1d0|_disconnect|lid|_1c0|_connect|_set|_195|_185|_183|_17d|_everyOrSome|_16b|_172|_15b|Function|_154|_escapeString|_140|chain|_check|canceller|_12d|_124|_11a|_10d|_107|inherited|_fa|_f2|_findMixin|_constructor|preamble|_de|clone|tmp|_c7|TMP|_be|_ba|_mixin|isBrowser|lang|firebug||param|modulePaths|_a7|_fireCallback|_a0|setContext||_9c|unloaded||||_96|_93|navigator|_90|_89||protocol|_84|_86|_XMLHTTP_PROGIDS|gears|google|setAttribute|_80|_77|cfg|_6f|_getModuleSymbols|_5a|_58|_53|_4d|_4c|_45|_40|_moduleHasPrefix|_loadUri|_28|_26|_21|_22|tests|doh|_20|_1f|_1c|version|_1b|_19|_getProp|_11|_4|_4a5|_4b3|_Animation|tempColor|blendColors|PI|sin|||||_49a|normal|onEnd||rate||curr|onStop|_497||_496|pct|onPause|onPlay|onBegin|delay||_491|_Line|_48b|wrapForm|PUT|_487|POST|GET|_476|_474|_472|_ioWatch|send|_471|setRequestHeader|open|callback|setInterval|_470|resHandle|_46f|ioCheck|_46e|validCheck|getTime|_ioCancelAll|addOnUnload|clearInterval|dojoType|now|canceled|_blockAsync|_45e|_45c|_459|_ioSetArgs|_contentHandlers|abort|_458|_456||||addErrback|_454|addCallback|_452|_44b|_44a|_449|preventCache|responseXML|Microsoft|JSON|usePlainJson|_431|toJson|_430|_42d|image|opt|ria|_421|_41b|_40b|_zip|_410|_40d|_357|sqf|_374|_3e5|_3df|_38f|clc|pred|parseInt|ntf|_3bf|_3bc|cnl|previousSibling|_3a9|_3a6|_39c|_399|_396|_392|__cachedIndex|__cachedLength|_376|iterateNext|_34a|_355|_354|_32c|_350|_34b|_33f|_33e|_33a|_338|_334|_332||_330|_32e||_322|_316|mousemove|mouseout|mouseover|_305|lastChild||_2f9||_2f2|_2f1|removeChild|_2ec|_2eb|_2ea|_2e6||_2e4|_2e2|_2d6|_2d5|_2d4|_2d3|_2d2|_2d1|_2cd|_2cc|scs|write|_2c8|hasClass|_2c0|_2bb|_2b5|_abs|_docScroll|offsetParent|offsetTop|offsetLeft|absolute|getBoxObjectFor|clientLeft|_setContentSize|_setMarginBox|_28d|_286|_285|_289|NaN|_281|border|_272|_26b|_260|_258|_253|_24c|_246|_23a|_getOpacity|_setOpacity|_238|td|tr|nodeName|FILTER|_22f|_22e|currentStyle|_22c|_22b|display|QuirksMode|unselectable|_217|isMozilla|getElementById|attributes|all|_ie_listener|_getIeDispatcher|_1fd|NUM_LOCK|SCROLL_LOCK|INSERT|END|HOME|PAUSE|F12|F11|F10|F9|F8|F7|F6|F5|F4|F3|F2|F1|63232|SHIFT_TAB|TAB|keyIdentifier|_1f3|stopEvent|_punctMap|222|219|186|onkeypress|_stealthKeyDown|_fixKeys|relatedTarget|_1e0|_1df|_stealthKeydown|_1d6|_1d5|_1d1|_1ca|_1c9|_1cb|_1c2|_1c1|_1c3|_1c4|_1bc|_1b3|_1b2|colorFromHex|colorFromRgb|named|colorFromString|mask|rgba|_19c|_197|_192|setColor|_180|_178|_177|_175|_174|_16d|_166|_164|_163|_162|_15c|_15d|_15e|index|__json__|toJsonIndentStr|_nextId|_12f|_12b|publish|_128|_126|_125|_122|_121|_123|_11c|_11b|_10c|_10b|_108|getDispatcher|argument|nom|_construct|_core|_makeCtor|_df|_db|deprecated|isObject|_cc||scope||_hitchArgs|_c2||pre|_c1|native|isDebug||registerModulePath|_a8||finally|||_a6|_a5|_a4|_a3|_a2|_a1|_9f|_9e|_9d|_9b|_98|_97|onbeforeunload|ipt|scr|complete|_95|userAgent|_modulesLoaded|initialized|_initFired|_8c|_8a|_getText|_87|ieForceActiveXXhr|Msxml2|isGears|_81|_gearsObject|googlegears|GearsFactory|isFF|_7d|Safari|_72|_name|_6c|ire|ore|_68|i18n|_5b|requireIf|_56|_52|loading|_4a|_loadPath|_47|_48|_global_omit_module_check|_getModulePrefix|_3c|_3a|_37|_30|Boolean|_loadUriAndCheck|_2e||cacheBust|_1e|_1a|_17|_16|_15|_14|_f|_10|_e|_9|_8|revision|flag|patch|minor|major|_6|color|units|needs|stopped|playing|stop|gotoPercent|pause|1000|implemented|yet|_48a|xhrDelete|rawXhrPut|xhrPut|postData|rawXhrPost|xhrPost|xhrGet|Type|Content|sync|response|http|bad|urlencoded|www|_watchInFlightError||exceeded|handle|action|getAttributeNode|loadXML|async|XMLDOM|prefixes|MSXML3|MSXML|MSXML2||xml|javascript|wasn|your|optional|message|off|turn|use|endpoints|issues|security|potential|avoid|mimetype|using|consider|please|decodeURIComponent|queryToObject|formToJson|formToQuery|encodeURIComponent|selected|option|multiple|checked|checkbox|radio|disabled|textarea|select|button|reset|submit|input|_3fb|hasAttribute|0n|even|odd|nth|_3b5|empty|_3b1|_3ad|htmlFor|_38a|under||exprssion|failure|ANY_TYPE|XPathResult|starts|keyup|keydown|mouseup|mousedown|blur|click|combine|span|addContent||adopt|orphan|_2de|_2dd|styles|_2da|_2d9|_2cf|_2ce|show|createPopup|toggleClass|scrollWidth|clientTop|ltr|direction|pageXOffset|pageYOffset|fixed|contentBox|marginBox|BUTTON|TABLE|_getBorderBox|clientHeight|visible|overflow|marginBottom|marginRight|marginTop|marginLeft|borderBottomWidth|borderBottomStyle|borderRightWidth|borderRightStyle|borderTopWidth|borderTopStyle|borderLeftWidth|borderLeftStyle|paddingBottom|paddingRight|paddingTop|paddingLeft|offset||min|padding||margin|Opacity|Alpha|alpha|filters|pixelLeft|medium|_22a|defaultView|before||insertBefore|KhtmlUserSelect|MozUserSelect|setSelectable|isDescendant|div|_destroyElement|BackgroundImageCache|execCommand|PageDown|PageUp|Right|Left|Down|Up|63289|63249|63248|PRINT_SCREEN|63302|63277|63276|63275|63273|63272|63250|63247|63246|63245|63244|63243|63242|63241|63240|63239|63238|63237|63236|63235|63234|63233|Enter|_1f9|which|_1f6|bubbledKeyCode|221|220||||191|190|189|188|187|toElement|fromElement|clientY|pageY||clientX|pageX|offsetY|||layerY|offsetX|layerX|parentWindow|_nop|_allow_leaks|145|144|126|F15|125|F14|124|F13|123|122|121|120|119|118|117|116|115|114|113|112|NUMPAD_DIVIDE|110|NUMPAD_PERIOD|109|NUMPAD_MINUS|108|NUMPAD_ENTER|107|NUMPAD_PLUS|NUMPAD_MULTIPLY|105|NUMPAD_9|104|NUMPAD_8|103|NUMPAD_7|102|NUMPAD_6|101|NUMPAD_5|NUMPAD_4||NUMPAD_3|NUMPAD_2|NUMPAD_1|NUMPAD_0||SELECT|RIGHT_WINDOW||LEFT_WINDOW||HELP|SPACE|ESCAPE|CAPS_LOCK|ALT|CTRL|SHIFT|ENTER|CLEAR|BACKSPACE|attachEvent|fixEvent|fromCharCode|keyChar|_1b9|removeEventListener|0x|round|toHex|toRgba|toRgb|aqua|teal|blue|navy|yellow|olive|lime|green|fuchsia|purple|red|maroon|white|gray|silver|black|boolean|called|already|Cancelled|connectPublisher|unsubscribe|subscribe|disconnect|_113|_112||_111|_110|||found|was||must|_|module|||required|likely|It|declaration|Mixin|separate|instead|property|initializer||pass|_c9|_bb|_b7|nfunction|isAlien|isFinite|isArrayLike|_firebug|withDoc|withGlobal|_writeIncludes|VML|behavior|addRule|createStyleSheet|vml|com|microsoft|schemas|urn|namespaces|onunload|onreadystatechange|defer|khtml|WebKit|DOMContentLoaded|enableMozDomContentLoaded|domcontentloaded|Unable|base|chrome|1223|304|300|200|available|XMLHttpRequest|_println|language|userLanguage|isQuirks|factory|mimeTypes|Factory|Gears|_7f|MSIE||Firefox|Gecko|Konqueror||Opera|appVersion|xd|browser|moduleUrl|port|host|hostenv|_requireLocalization|_5f|_5e|_5d|_5c|requireLocalization|requireAfterIf|_57|common|platformRequire|defined|symbol|_isXDomain|tried|Could|__package__|packageFileName|_42|useXDomain|flight|still|files|addOnLoad|failed|sourceURL|util|notice|without|change|subject|APIs|EXPERIMENTAL|experimental|removed|will|DEPRECATED|exists|10315|Rev|Mobile|Spidermonkey|Rhino||Browser|delayMozLoadingFix|preventBackButtonFix|libraryScriptUri|baseRelativePath|baseScriptUri|allowQueryConfig|warn|trace|timeEnd||time|profileEnd|profile|log|info|groupEnd|group|dirxml|dir|count|assert'.split('|'),0,{}); + + +/* + +Prototype 1.5 rc0 + - Adapted from Ruby on Rails - http://dev.rubyonrails.org/browser/spinoffs/prototype/src + - By Lunarmedia, 06 August, 2006 + - Available at (and packed with) JavascriptCompressor.com + +Please note this version is missing the selector.js component of the full Prototype library. +You can get the compressed version of selector at JavascriptCompressor.com + +*/ + +var decompressedPrototype = function(p,a,c,k,e,d){e=function(c){return(c35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)){while(c--){d[e(c)]=k[c]||e(c)}k=[(function(e){return d[e]})];e=(function(){return'\\w+'});c=1};while(c--){if(k[c]){p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c])}}return p}('d T={4l:\'1.5.8P\',3E:\'(?:<3G.*?>)((\\n|\\r|.)*?)(?:<\\/3G>)\',2v:7(){},K:7(x){c x}};d 1b={17:7(){c 7(){6.1I.2n(6,N)}}};d 1e=z q();q.u=7(5d,O){G(d 1G 2M O){5d[1G]=O[1G]}c 5d};q.1U=7(U){1j{f(U==1v)c\'1v\';f(U==1L)c\'1L\';c U.1U?U.1U():U.2C()}1s(e){f(e 8R 9l)c\'...\';25 e}};7j.v.1d=7(){d 43=6,23=$A(N),U=23.8S();c 7(){c 43.2n(U,23.3s($A(N)))}};7j.v.8U=7(U){d 43=6;c 7(C){c 43.8V(U,C||1W.C)}};q.u(8Q.v,{8W:7(){d 4Z=6.2C(16);f(6<16)c\'0\'+4Z;c 4Z},5j:7(){c 6+1},8Y:7(o){$R(0,6,11).V(o);c 6}});d 6s={6j:7(){d 48;G(d i=0;i0){f(I=O.I(1A)){L+=O.47(0,I.w);L+=(1z(I)||\'\').2C();O=O.47(I.w+I[0].t)}1D{L+=O,O=\'\'}}c L},92:7(1A,1z,3i){1z=6.2T.52(1z);3i=3i===1v?1:3i;c 6.2T(1A,7(I){f(--3i<0)c I[0];c 1z(I)})},93:7(1A,o){6.2T(1A,o);c 6},94:7(t,2S){t=t||30;2S=2S===1v?\'...\':2S;c 6.t>t?6.47(0,t-2S.t)+2S:6},9F:7(){c 6.2y(/^\\s+/,\'\').2y(/\\s+$/,\'\')},71:7(){c 6.2y(/<\\/?[^>]+>/7Y,\'\')},2Q:7(){c 6.2y(z 3O(T.3E,\'5P\'),\'\')},70:7(){d 6Y=z 3O(T.3E,\'5P\');d 5p=z 3O(T.3E,\'98\');c(6.I(6Y)||[]).1C(7(5o){c(5o.I(5p)||[\'\',\'\'])[1]})},3q:7(){c 6.70().1C(7(3G){c 4q(3G)})},9E:7(){d 1q=J.4Y(\'1q\');d 1Y=J.9D(6);1q.75(1Y);c 1q.3h},9c:7(){d 1q=J.4Y(\'1q\');1q.3h=6.71();c 1q.2z[0]?1q.2z[0].6q:\'\'},78:7(){d 7i=6.I(/^\\??(.*)$/)[1].3j(\'&\');c 7i.36({},7(5b,72){d 1i=72.3j(\'=\');5b[1i[0]]=1i[1];c 5b})},1Z:7(){c 6.3j(\'\')},3P:7(){d 2l=6.3j(\'-\');f(2l.t==1)c 2l[0];d 54=6.5g(\'-\')==0?2l[0].7e(0).3Y()+2l[0].7g(1):2l[0];G(d i=1,73=2l.t;i<73;i++){d s=2l[i];54+=s.7e(0).3Y()+s.7g(1)}c 54},1U:7(){c"\'"+6.2y(/\\\\/g,\'\\\\\\\\\').2y(/\'/g,\'\\\\\\\'\')+"\'"}});4b.v.2T.52=7(1z){f(2i 1z==\'7\')c 1z;d 2U=z 3n(1z);c 7(I){c 2U.7a(I)}};4b.v.9h=4b.v.78;d 3n=1b.17();3n.79=/(^|.|\\r|\\n)(#\\{(.*?)\\})/;3n.v={1I:7(2U,1A){6.2U=2U.2C();6.1A=1A||3n.79},7a:7(U){c 6.2U.2T(6.1A,7(I){d 53=I[1];f(53==\'\\\\\')c I[2];c 53+(U[I[3]]||\'\').2C()})}};d $1y=z q();d $49=z q();d 1p={V:7(o){d w=0;1j{6.2m(7(h){1j{o(h,w++)}1s(e){f(e!=$49)25 e}})}1s(e){f(e!=$1y)25 e}},9n:7(o){d L=11;6.V(7(h,w){L=L&&!!(o||T.K)(h,w);f(!L)25 $1y});c L},9o:7(o){d L=11;6.V(7(h,w){f(L=!!(o||T.K)(h,w))25 $1y});c L},3e:7(o){d P=[];6.V(7(h,w){P.W(o(h,w))});c P},7n:7(o){d L;6.V(7(h,w){f(o(h,w)){L=h;25 $1y}});c L},7o:7(o){d P=[];6.V(7(h,w){f(o(h,w))P.W(h)});c P},9p:7(1A,o){d P=[];6.V(7(h,w){d 7c=h.2C();f(7c.I(1A))P.W((o||T.K)(h,w))});c P},1M:7(U){d 51=Y;6.V(7(h){f(h==U){51=11;25 $1y}});c 51},36:7(45,o){6.V(7(h,w){45=o(45,h,w)});c 45},9q:7(1F){d 23=$A(N).47(1);c 6.3e(7(h){c h[1F].2n(h,23)})},9s:7(o){d L;6.V(7(h,w){h=(o||T.K)(h,w);f(L==1v||h>=L)L=h});c L},9u:7(o){d L;6.V(7(h,w){h=(o||T.K)(h,w);f(L==1v||hb?1:0}).3r(\'h\')},1Z:7(){c 6.3e(T.K)},9B:7(){d o=T.K,23=$A(N);f(2i 23.5e()==\'7\')o=23.9C();d 7l=[6].3s(23).1C($A);c 6.1C(7(h,w){c o(7l.3r(w))})},1U:7(){c\'#<1p:\'+6.1Z().1U()+\'>\'}};q.u(1p,{1C:1p.3e,5v:1p.7n,1k:1p.7o,8M:1p.1M,7p:1p.1Z});d $A=1E.7q=7(2R){f(!2R)c[];f(2R.1Z){c 2R.1Z()}1D{d P=[];G(d i=0;i<2R.t;i++)P.W(2R[i]);c P}};q.u(1E.v,1p);f(!1E.v.4d)1E.v.4d=1E.v.4m;q.u(1E.v,{2m:7(o){G(d i=0;i<6.t;i++)o(6[i])},5i:7(){6.t=0;c 6},7r:7(){c 6[0]},5e:7(){c 6[6.t-1]},7s:7(){c 6.1k(7(h){c h!=1v||h!=1L})},6J:7(){c 6.36([],7(6H,h){c 6H.3s(h&&h.5D==1E?h.6J():[h])})},5s:7(){d 4N=$A(N);c 6.1k(7(h){c!4N.1M(h)})},5g:7(U){G(d i=0;i<6.t;i++)f(6[i]==U)c i;c-1},4m:7(5h){c(5h!==Y?6:6.1Z()).4d()},1U:7(){c\'[\'+6.1C(q.1U).1N(\', \')+\']\'}});d 4h={2m:7(o){G(d 1O 2M 6){d h=6[1O];f(2i h==\'7\')49;d 1i=[1O,h];1i.1O=1O;1i.h=h;o(1i)}},7t:7(){c 6.3r(\'1O\')},4N:7(){c 6.3r(\'h\')},7u:7(2N){c $H(2N).36($H(6),7(4Q,1i){4Q[1i.1O]=1i.h;c 4Q})},7w:7(){c 6.1C(7(1i){c 1i.1C(4n).1N(\'=\')}).1N(\'&\')},1U:7(){c\'#<4h:{\'+6.1C(7(1i){c 1i.1C(q.1U).1N(\': \')}).1N(\', \')+\'}>\'}};7 $H(U){d 2N=q.u({},U||{});q.u(2N,1p);q.u(2N,4h);c 2N};3L=1b.17();q.u(3L.v,1p);q.u(3L.v,{1I:7(22,2x,2H){6.22=22;6.2x=2x;6.2H=2H},2m:7(o){d h=6.22;2q{o(h);h=h.5j()}1H(6.1M(h))},1M:7(h){f(h<6.22)c Y;f(6.2H)c h<6.2x;c h<=6.2x}});d $R=7(22,2x,2H){c z 3L(22,2x,2H)};d M={4w:7(){c 6s.6j(7(){c z 5C()},7(){c z 5n(\'7y.6d\')},7(){c z 5n(\'7z.6d\')})||Y},4s:0};M.2W={3b:[],2m:7(o){6.3b.2m(o)},69:7(4F){f(!6.1M(4F))6.3b.W(4F)},7A:7(5t){6.3b=6.3b.5s(5t)},3y:7(1a,26,E,2Z){6.V(7(3o){f(3o[1a]&&2i 3o[1a]==\'7\'){1j{3o[1a].2n(3o,[26,E,2Z])}1s(e){}}})}};q.u(M.2W,1p);M.2W.69({5G:7(){M.4s++},1B:7(){M.4s--}});M.44=7(){};M.44.v={4a:7(m){6.m={1F:\'4j\',4p:11,5H:\'5E/x-86-Q-7C\',28:\'\'};q.u(6.m,m||{})},3l:7(){c 6.E.32==1v||6.E.32==0||(6.E.32>=84&&6.E.32<7E)},7G:7(){c!6.3l()}};M.3t=1b.17();M.3t.5L=[\'7H\',\'80\',\'7I\',\'7J\',\'4t\'];M.3t.v=q.u(z M.44(),{1I:7(1l,m){6.E=M.4w();6.4a(m);6.26(1l)},26:7(1l){d 28=6.m.28||\'\';f(28.t>0)28+=\'&7K=\';1j{6.1l=1l;f(6.m.1F==\'7L\'&&28.t>0)6.1l+=(6.1l.I(/\\?/)?\'&\':\'?\')+28;M.2W.3y(\'5G\',6,6.E);6.E.7N(6.m.1F,6.1l,6.m.4p);f(6.m.4p){6.E.5T=6.5J.1d(6);2Y((7(){6.4r(1)}).1d(6),10)}6.5A();d 1c=6.m.5V?6.m.5V:28;6.E.7O(6.m.1F==\'4j\'?1c:1L)}1s(e){6.3p(e)}},5A:7(){d 1P=[\'X-7P-7Q\',\'5C\',\'X-T-4l\',T.4l,\'7R\',\'1Y/7m, 1Y/2e, 5E/5F, 1Y/5F, */*\'];f(6.m.1F==\'4j\'){1P.W(\'5Q-2g\',6.m.5H);f(6.E.7S)1P.W(\'7T\',\'7U\')}f(6.m.1P)1P.W.2n(1P,6.m.1P);G(d i=0;i<1P.t;i+=2)6.E.7V(1P[i],1P[i+1])},5J:7(){d 2F=6.E.2F;f(2F!=1)6.4r(6.E.2F)},4A:7(B){1j{c 6.E.7W(B)}1s(e){}},5M:7(){1j{c 4q(\'(\'+6.4A(\'X-7X\')+\')\')}1s(e){}},5R:7(){1j{c 4q(6.E.3F)}1s(e){6.3p(e)}},4r:7(2F){d C=M.3t.5L[2F];d E=6.E,2Z=6.5M();f(C==\'4t\'){1j{(6.m[\'2I\'+6.E.32]||6.m[\'2I\'+(6.3l()?\'81\':\'82\')]||T.2v)(E,2Z)}1s(e){6.3p(e)}f((6.4A(\'5Q-2g\')||\'\').I(/^1Y\\/7m/i))6.5R()}1j{(6.m[\'2I\'+C]||T.2v)(E,2Z);M.2W.3y(\'2I\'+C,6,E,2Z)}1s(e){6.3p(e)}f(C==\'4t\')6.E.5T=T.2v},3p:7(57){(6.m.5W||T.2v)(6,57);M.2W.3y(\'5W\',6,57)}});M.4C=1b.17();q.u(q.u(M.4C.v,M.3t.v),{1I:7(1w,1l,m){6.4x={3m:1w.3m?$(1w.3m):$(1w),3z:1w.3z?$(1w.3z):(1w.3m?1L:$(1w))};6.E=M.4w();6.4a(m);d 1B=6.m.1B||T.2v;6.m.1B=(7(E,U){6.5Y();1B(E,U)}).1d(6);6.26(1l)},5Y:7(){d 3A=6.3l()?6.4x.3m:6.4x.3z;d 3k=6.E.3F;f(!6.m.3q)3k=3k.2Q();f(3A){f(6.m.60){z 6.m.60(3A,3k)}1D{k.6h(3A,3k)}}f(6.3l()){f(6.1B)2Y(6.1B.1d(6),10)}}});M.61=1b.17();M.61.v=q.u(z M.44(),{1I:7(1w,1l,m){6.4a(m);6.1B=6.m.1B;6.1J=(6.m.1J||2);6.2s=(6.m.2s||1);6.4B={};6.1w=1w;6.1l=1l;6.22()},22:7(){6.m.1B=6.63.1d(6);6.2D()},7b:7(){6.4B.1B=1v;89(6.65);(6.1B||T.2v).2n(6,N)},63:7(26){f(6.m.2s){6.2s=(26.3F==6.64?6.2s*6.m.2s:1);6.64=26.3F}6.65=2Y(6.2D.1d(6),6.2s*6.1J*4z)},2D:7(){6.4B=z M.4C(6.1w,6.1l,6.m)}});7 $(){d P=[],4;G(d i=0;i<4V>\'+6.2t+\'\';c $A(1q.2z[0].2z[0].2z)}};d 1g=z q();1g.6W=1b.17();1g.6W.v=q.u(z 1e.1g(\'96\'),{2V:7(){6.1K.97(6.4)},2X:7(2h){2h.V((7(2j){6.4.1X.55(2j,6.4)}).1d(6))}});1g.5m=1b.17();1g.5m.v=q.u(z 1e.1g(\'99\'),{2V:7(){6.1K.56(6.4);6.1K.74(11)},2X:7(2h){2h.4m(Y).V((7(2j){6.4.55(2j,6.4.9a)}).1d(6))}});1g.7h=1b.17();1g.7h.v=q.u(z 1e.1g(\'9d\'),{2V:7(){6.1K.56(6.4);6.1K.74(6.4)},2X:7(2h){2h.V((7(2j){6.4.75(2j)}).1d(6))}});1g.76=1b.17();1g.76.v=q.u(z 1e.1g(\'9i\'),{2V:7(){6.1K.9m(6.4)},2X:7(2h){2h.V((7(2j){6.4.1X.55(2j,6.4.9t)}).1d(6))}});k.3S=1b.17();k.3S.v={1I:7(4){6.4=$(4)},2m:7(o){6.4.1f.3j(/\\s+/).1k(7(B){c B.t>0}).2m(o)},5c:7(1f){6.4.1f=1f},7k:7(5a){f(6.1M(5a))c;6.5c(6.1Z().3s(5a).1N(\' \'))},42:7(4c){f(!6.1M(4c))c;6.5c(6.1k(7(1f){c 1f!=4c}).1N(\' \'))},2C:7(){c 6.1Z().1N(\' \')}};q.u(k.3S.v,1p);d 5I={5i:7(){G(d i=0;i=0){2b=4.m[w];h=2b.h||2b.1Y}c[4.B,h]},5X:7(4){d h=[];G(d i=0;i<4.t;i++){d 2b=4.m[i];f(2b.87)h.W(2b.h||2b.1Y)}c[4.B,h]}};d $F=D.k.1x;1e.3D=7(){};1e.3D.v={1I:7(4,1J,1a){6.1J=1J;6.4=$(4);6.1a=1a;6.2K=6.1x();6.2A()},2A:7(){5Z(6.2D.1d(6),6.1J*4z)},2D:7(){d h=6.1x();f(6.2K!=h){6.1a(6.4,h);6.2K=h}}};D.k.3C=1b.17();D.k.3C.v=q.u(z 1e.3D(),{1x:7(){c D.k.1x(6.4)}});D.3C=1b.17();D.3C.v=q.u(z 1e.3D(),{1x:7(){c D.3a(6.4)}});1e.2c=7(){};1e.2c.v={1I:7(4,1a){6.4=$(4);6.1a=1a;6.2K=6.1x();f(6.4.1h.2w()==\'Q\')6.67();1D 6.2A(6.4)},4K:7(){d h=6.1x();f(6.2K!=h){6.1a(6.4,h);6.2K=h}},67:7(){d 12=D.2L(6.4);G(d i=0;i<12.t;i++)6.2A(12[i])},2A:7(4){f(4.2g){6c(4.2g.2w()){1r\'6g\':1r\'6i\':1o.3B(4,\'8j\',6.4K.1d(6));1y;1r\'6l\':1r\'1Y\':1r\'3J\':1r\'1k-6n\':1r\'1k-8t\':1o.3B(4,\'8u\',6.4K.1d(6));1y}}}};D.k.2c=1b.17();D.k.2c.v=q.u(z 1e.2c(),{1x:7(){c D.k.1x(6.4)}});D.2c=1b.17();D.2c.v=q.u(z 1e.2c(),{1x:7(){c D.3a(6.4)}});f(!1W.1o){d 1o=z q()}q.u(1o,{8C:8,8F:9,8H:13,8I:27,8J:37,8L:38,8O:39,8T:40,8X:46,4:7(C){c C.Z||C.91},95:7(C){c(((C.6X)&&(C.6X==1))||((C.6Z)&&(C.6Z==1)))},9b:7(C){c C.9e||(C.9f+(J.3R.2G||J.1c.2G))},9g:7(C){c C.9j||(C.9k+(J.3R.2O||J.1c.2O))},7b:7(C){f(C.7d){C.7d();C.9r()}1D{C.48=Y;C.9w=11}},9A:7(C,1h){d 4=1o.4(C);1H(4.1X&&(!4.1h||(4.1h.3Y()!=1h.3Y())))4=4.1X;c 4},1T:Y,5u:7(4,B,1V,1u){f(!6.1T)6.1T=[];f(4.5f){6.1T.W([4,B,1V,1u]);4.5f(B,1V,1u)}1D f(4.4i){6.1T.W([4,B,1V,1u]);4.4i(\'2I\'+B,1V)}},66:7(){f(!1o.1T)c;G(d i=0;i<1o.1T.t;i++){1o.5N.2n(6,1o.1T[i]);1o.1T[i][0]=1L}1o.1T=Y},3B:7(4,B,1V,1u){d 4=$(4);1u=1u||Y;f(B==\'5U\'&&(33.4u.I(/3x|3w|3u/)||4.4i))B=\'5K\';6.5u(4,B,1V,1u)},5N:7(4,B,1V,1u){d 4=$(4);1u=1u||Y;f(B==\'5U\'&&(33.4u.I(/3x|3w|3u/)||4.4k))B=\'5K\';f(4.5x){4.5x(B,1V,1u)}1D f(4.4k){1j{4.4k(\'2I\'+B,1V)}1s(e){}}}});f(33.4u.I(/\\88\\b/))1o.3B(1W,\'8a\',1o.66,Y);d 2d={6o:Y,4P:7(){6.6z=1W.8e||J.3R.2G||J.1c.2G||0;6.6F=1W.8g||J.3R.2O||J.1c.2O||0},6u:7(4){d 19=0,15=0;2q{19+=4.2O||0;15+=4.2G||0;4=4.1X}1H(4);c[15,19]},35:7(4){d 19=0,15=0;2q{19+=4.29||0;15+=4.2f||0;4=4.1Q}1H(4);c[15,19]},68:7(4){d 19=0,15=0;2q{19+=4.29||0;15+=4.2f||0;4=4.1Q;f(4){p=k.1R(4,\'14\');f(p==\'3T\'||p==\'2o\')1y}}1H(4);c[15,19]},1Q:7(4){f(4.1Q)c 4.1Q;f(4==J.1c)c 4;1H((4=4.1X)&&4!=J.1c)f(k.1R(4,\'14\')!=\'4G\')c 4;c J.1c},8o:7(4,x,y){f(6.6o)c 6.6r(4,x,y);6.3g=x;6.34=y;6.1t=6.35(4);c(y>=6.1t[1]&&y<6.1t[1]+4.2k&&x>=6.1t[0]&&x<6.1t[0]+4.2p)},6r:7(4,x,y){d 4S=6.6u(4);6.3g=x+4S[0]-6.6z;6.34=y+4S[1]-6.6F;6.1t=6.35(4);c(6.34>=6.1t[1]&&6.34<6.1t[1]+4.2k&&6.3g>=6.1t[0]&&6.3g<6.1t[0]+4.2p)},8E:7(3Z,4){f(!3Z)c 0;f(3Z==\'8G\')c((6.1t[1]+4.2k)-6.34)/4.2k;f(3Z==\'8K\')c((6.1t[0]+4.2p)-6.3g)/4.2p},77:7(O,Z){O=$(O);Z=$(Z);Z.l.14=\'2o\';d 2P=6.35(O);Z.l.1n=2P[1]+\'1m\';Z.l.18=2P[0]+\'1m\';Z.l.21=O.2p+\'1m\';Z.l.24=O.2k+\'1m\'},4e:7(4M){d 19=0,15=0;d 4=4M;2q{19+=4.29||0;15+=4.2f||0;f(4.1Q==J.1c)f(k.1R(4,\'14\')==\'2o\')1y}1H(4=4.1Q);4=4M;2q{19-=4.2O||0;15-=4.2G||0}1H(4=4.1X);c[15,19]},77:7(O,Z){d m=q.u({5l:11,5r:11,5B:11,5q:11,29:0,2f:0},N[2]||{});O=$(O);d p=2d.4e(O);Z=$(Z);d 2J=[0,0];d 3v=1L;f(k.1R(Z,\'14\')==\'2o\'){3v=2d.1Q(Z);2J=2d.4e(3v)}f(3v==J.1c){2J[0]-=J.1c.2f;2J[1]-=J.1c.29}f(m.5l)Z.l.18=(p[0]-2J[0]+m.2f)+\'1m\';f(m.5r)Z.l.1n=(p[1]-2J[1]+m.29)+\'1m\';f(m.5B)Z.l.21=O.2p+\'1m\';f(m.5q)Z.l.24=O.2k+\'1m\'},8b:7(4){4=$(4);f(4.l.14==\'2o\')c;2d.4P();d 2P=2d.68(4);d 1n=2P[1];d 18=2P[0];d 21=4.6m;d 24=4.6p;4.6P=18-3X(4.l.18||0);4.6I=1n-3X(4.l.1n||0);4.5k=4.l.21;4.7f=4.l.24;4.l.14=\'2o\';4.l.1n=1n+\'1m\';4.l.18=18+\'1m\';4.l.21=21+\'1m\';4.l.24=24+\'1m\'},8w:7(4){4=$(4);f(4.l.14==\'3T\')c;2d.4P();4.l.14=\'3T\';d 1n=3X(4.l.1n||0)-(4.6I||0);d 18=3X(4.l.18||0)-(4.6P||0);4.l.1n=1n+\'1m\';4.l.18=18+\'1m\';4.l.24=4.7f;4.l.21=4.5k}};f(/3x|3w|3u/.4v(33.62)){2d.35=7(4){d 19=0,15=0;2q{19+=4.29||0;15+=4.2f||0;f(4.1Q==J.1c)f(k.1R(4,\'14\')==\'2o\')1y;4=4.1Q}1H(4);c[15,19]}};',62,600,'||||element||this|function|||||return|var||if||value|||Element|style|options||iterator||Object|||length|extend|prototype|index|||new||name|event|Form|transport||for||match|document||result|Ajax|arguments|source|results|form|||Prototype|object|each|push||false|target||true|elements||position|valueL||create|left|valueT|callback|Class|body|bind|Abstract|className|Insertion|tagName|pair|try|select|url|px|top|Event|Enumerable|div|case|catch|offset|useCapture|undefined|container|getValue|break|replacement|pattern|onComplete|map|else|Array|method|property|while|initialize|frequency|range|null|include|join|key|requestHeaders|offsetParent|getStyle|parameter|observers|inspect|observer|window|parentNode|text|toArray|els|width|start|args|height|throw|request||parameters|offsetTop|methods|opt|EventObserver|Position|html|offsetLeft|type|fragments|typeof|fragment|offsetHeight|oStringList|_each|apply|absolute|offsetWidth|do|cache|decay|content|input|emptyFunction|toLowerCase|end|replace|childNodes|registerCallback|display|toString|onTimerEvent|Serializers|readyState|scrollLeft|exclusive|on|delta|lastValue|getElements|in|hash|scrollTop|offsets|stripScripts|iterable|truncation|gsub|template|initializeRange|Responders|insertContent|setTimeout|json||hidden|status|navigator|ycomp|cumulativeOffset|inject||||serialize|responders|_overflow|Methods|collect|adjacency|xcomp|innerHTML|count|split|response|responseIsSuccess|success|Template|responder|dispatchException|evalScripts|pluck|concat|Request|KHTML|parent|Safari|Konqueror|dispatch|failure|receiver|observe|Observer|TimedObserver|ScriptFragment|responseText|script|inputs|ancestor|textarea|classNames|ObjectRange|node|typeName|RegExp|camelize|none|documentElement|ClassNames|relative|right|overflow|HTMLElement|parseFloat|toUpperCase|mode||currentlyExecuting|remove|__method|Base|memo||slice|returnValue|continue|setOptions|String|classNameToRemove|_reverse|page|focus|queryComponent|Hash|attachEvent|post|detachEvent|Version|reverse|encodeURIComponent|disabled|asynchronous|eval|respondToReadyState|activeRequestCount|Complete|appVersion|test|getTransport|containers|matchingInputs|1000|header|updater|Updater|getElementsByTagName|child|responderToAdd|static|tagElements|queryComponents|defaultView|onElementEvent|css|forElement|values|visibility|prepare|mergedHash|pos|offsetcache|_madePositioned|visible|tbody|findOrStore|_nativeExtensions|createElement|digits|trues|found|prepareReplacement|before|camelizedString|insertBefore|selectNodeContents|exception|falses|criteria|classNameToAdd|params|set|destination|last|addEventListener|indexOf|inline|clear|succ|_originalWidth|setLeft|Top|ActiveXObject|scriptTag|matchOne|setHeight|setTop|without|responderToRemove|_observeAndCache|find|reset|removeEventListener|activate|findFirstElement|setRequestHeaders|setWidth|XMLHttpRequest|constructor|application|xml|onCreate|contentType|Field|onStateChange|keydown|Events|evalJSON|stopObserving|inputSelector|img|Content|evalResponse|selectOne|onreadystatechange|keypress|postBody|onException|selectMany|updateContent|setInterval|insertion|PeriodicalUpdater|userAgent|updateComplete|lastText|timer|unloadCache|registerFormCallbacks|positionedOffset|register|parentElement|children|switch|XMLHTTP|_extended|hide|checkbox|update|radio|these|outerHTML|password|clientWidth|one|includeScrollOffsets|clientHeight|nodeValue|withinIncludingScrolloffsets|Try|scrollTo|realOffset|getComputedStyle|show|currentStyle|auto|deltaX|originalPosition|originalVisibility|originalWidth|originalHeight|opera|deltaY|bottom|array|_originalTop|flatten|addMethods|lambda|Toggle|toggle|insertAdjacentHTML|_originalLeft|PeriodicalExecuter|ownerDocument|createRange|createContextualFragment|contentFromAnonymousTable|table|Before|which|matchAll|button|extractScripts|stripTags|pairString|len|collapse|appendChild|After|clone|toQueryParams|Pattern|evaluate|stop|stringValue|preventDefault|charAt|_originalHeight|substring|Bottom|pairs|Function|add|collections|javascript|detect|findAll|entries|from|first|compact|keys|merge|present|toQueryString|getInputs|Msxml2|Microsoft|unregister|disable|urlencoded|blur|300|enable|responseIsFailure|Uninitialized|Loaded|Interactive|_|get|focusFirstElement|open|send|Requested|With|Accept|overrideMimeType|Connection|close|setRequestHeader|getResponseHeader|JSON|gi|submit|Loading|Success|Failure|checked|200|selectedIndex|www|selected|bMSIE|clearTimeout|unload|absolutize|string|getElementById|pageXOffset|getElementsByClassName|pageYOffset|removeChild|replaceChild|click|getHeight|hasClassName|addClassName|removeClassName|within|cleanWhitespace|nodeType|empty|childOf|multiple|change|getPropertyValue|relativize|setStyle|getDimensions|makePositioned|undoPositioned|makeClipping|KEY_BACKSPACE|undoClipping|overlap|KEY_TAB|vertical|KEY_RETURN|KEY_ESC|KEY_LEFT|horizontal|KEY_UP|member|tr|KEY_RIGHT|0_RC_0|Number|instanceof|shift|KEY_DOWN|bindAsEventListener|call|toColorPart|KEY_DELETE|times|finally|callee|srcElement|sub|scan|truncate|isLeftClick|beforeBegin|setStartBefore|im|afterBegin|firstChild|pointerX|unescapeHTML|beforeEnd|pageX|clientX|pointerY|parseQuery|afterEnd|pageY|clientY|RangeError|setStartAfter|all|any|grep|invoke|stopPropagation|max|nextSibling|min|partition|cancelBubble|reject|sortBy|sort|findElement|zip|pop|createTextNode|escapeHTML|strip'.split('|'),0,{}) + +} \ No newline at end of file diff --git a/SunSpider/tests/string-validate-input.js b/SunSpider/tests/string-validate-input.js new file mode 100644 index 0000000..3455b32 --- /dev/null +++ b/SunSpider/tests/string-validate-input.js @@ -0,0 +1,89 @@ +letters = new Array("a","b","c","d","e","f","g","h","i","j","k","l","m","n","o","p","q","r","s","t","u","v","w","x","y","z"); +numbers = new Array(1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26); +colors = new Array("FF","CC","99","66","33","00"); + +var endResult; + +function doTest() +{ + endResult = ""; + + // make up email address + for (var k=0;k<4000;k++) + { + name = makeName(6); + (k%2)?email=name+"@mac.com":email=name+"(at)mac.com"; + + // validate the email address + var pattern = /^[a-zA-Z0-9\-\._]+@[a-zA-Z0-9\-_]+(\.?[a-zA-Z0-9\-_]*)\.[a-zA-Z]{2,3}$/; + + if(pattern.test(email)) + { + var r = email + " appears to be a valid email address."; + addResult(r); + } + else + { + r = email + " does NOT appear to be a valid email address."; + addResult(r); + } + } + + // make up ZIP codes + for (var s=0;s<4000;s++) + { + var zipGood = true; + var zip = makeNumber(4); + (s%2)?zip=zip+"xyz":zip=zip.concat("7"); + + // validate the zip code + for (var i = 0; i < zip.length; i++) { + var ch = zip.charAt(i); + if (ch < "0" || ch > "9") { + zipGood = false; + r = zip + " contains letters."; + addResult(r); + } + } + if (zipGood && zip.length>5) + { + zipGood = false; + r = zip + " is longer than five characters."; + addResult(r); + } + if (zipGood) + { + r = zip + " appears to be a valid ZIP code."; + addResult(r); + } + } +} + +function makeName(n) +{ + var tmp = ""; + for (var i=0;i